Eif3h (NM_080635) Mouse Untagged Clone

SKU
MC210696
Eif3h (untagged) - Mouse eukaryotic translation initiation factor 3, subunit H (Eif3h), (10ug)
$503.00
4 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Eif3h
Synonyms 40kD; 1110008A16Rik; 9430017H16Rik; EIF3-gamma; EIF3-P40; Eif3s3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC210696 representing NM_080635
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGTCGCGCAAGGAAGGCACCGGCTCTACCGCCACCTCCTCCGGTTCTGCTGGCGGCGCGGTGGGGA
AGGGCAAAGGCAAAGGCGGCTCCGGAGATTCGGCCGTGAAGCAGGTGCAGATCGACGGCCTGGTAGTATT
AAAGATAATCAAACATTATCAAGAAGAAGGACAAGGCACTGAGGTTGTTCAGGGCGTGCTCCTGGGTCTG
GTTGTGGAAGACCGGCTAGAGATTACCAACTGCTTCCCGTTCCCCCAGCACACGGAGGATGATGCTGACT
TTGATGAGGTACAGTATCAGATGGAGATGATGCGCAGCCTTCGCCATGTCAACATTGATCACCTCCACGT
GGGCTGGTATCAGTCCACATATTACGGCTCCTTCGTTACCCGGGCGCTTCTGGATTCTCAGTTCAGCTAC
CAGCACGCCATTGAAGAGTCTGTCGTCCTCATTTATGATCCCATAAAAACTGCCCAAGGATCTCTCTCGC
TGAAGGCGTACAGACTGACTCCTAAACTGATGGAAGTTTGTAAAGAGAAGGACTTTTCCCCTGAAGCATT
GAAAAAGGCAAGCATCACCTTTGAGCACATGTTTGAAGAAGTGCCGATTGTAATTAAAAACTCACATCTG
ATCAATGTCCTTATGTGGGAACTTGAGAAGAAGTCAGCTGTGGCGGATAAGCACGAATTGCTCAGTCTTG
CTAGCAGCAATCATCTGGGGAAGAGCCTCCAGCTGCTGATGGACCGGGTGGACGAAATGAGCCAGGACAT
AATCAAATACAACACGTACATGCGCAACACCAGTAAGCAGCAGCAGCAGAAACATCAGTATCAGCAGCGT
CGCCAACAGGAGAATATGCAGCGACAGAGTCGAGGCGAGCCCCCACTCCCTGAGGAGGACCTCTCTAAAC
TCTTCAAGCCCCACCAGGCCCCTGCCAGGATGGATTCACTGCTCATTGCAGGCCAGATTAACACTTACTG
CCAGAACATCAAGGAGTTCACTGCCCAAAACTTAGGCAAACTCTTCATGGCCCAGGCTCTTCAAGAATAC
AATAATTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_080635
Insert Size 1059 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_080635.1, NP_542366.1
RefSeq Size 1254 bp
RefSeq ORF 1059 bp
Locus ID 68135
UniProt ID Q91WK2
Cytogenetics 15 C
Summary Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis. The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S pre-initiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation, including cell cycling, differentiation and apoptosis, and uses different modes of RNA stem-loop binding to exert either translational activation or repression.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Eif3h (NM_080635) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG205355 Eif3h (tGFP-tagged) - Mouse eukaryotic translation initiation factor 3, subunit 3 (gamma) (Eif3s3) 10 ug
$657.00
MR205355 Eif3h (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 3, subunit H (Eif3h) 10 ug
$289.00 MSRP $457.00 MSRP $457.00
MR205355L3 Lenti ORF clone of Eif3h (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 3, subunit H (Eif3h) 10 ug
$757.00
MR205355L4 Lenti ORF clone of Eif3h (mGFP-tagged) - Mouse eukaryotic translation initiation factor 3, subunit H (Eif3h) 10 ug
$757.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.