Ndufb8 (NM_026061) Mouse Untagged Clone

SKU
MC210512
Ndufb8 (untagged) - Mouse NADH dehydrogenase (ubiquinone) 1 beta subcomplex 8 (Ndufb8), nuclear gene encoding mitochondrial protein, (10ug)
$330.00
4 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ndufb8
Synonyms 2900010I05Rik; AI987932
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC210512 representing NM_026061
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGCCGCCCGGGCTGCGGCCCTGGGAGTCCGATGGCTGCAGAGGACAACCCGGGGCGTGGTGCCAC
TGGAGGCACGGAGAGCCTTCCATATGACCAAGGACATGTTGCCGGGGTCATATCCTAGGACCCCAGAGGA
ACGCGCCGCGGCCGCCAAGAAGTATAACATGCGAGTGGAAGACTACGAGCCATACCCCGATGATGGCATG
GGGTATGGCGACTACCCGATGCTCCCCAACCGATCACAGCATGAGAGGGATCCGTGGTATCAGTGGGACC
ACTCAGAACTCAGGATGAACTGGGGTGAACCGATACACTGGGACCTAGACATGTACATCAGGAATCGTGT
GGACACGTCACCTACCCCTGTGTCCTGGGATGTCATGTGTAAACATCTCTTCGGCTTTGTGGCTTTCATG
GTTTTCATGTTCTGGGTAGGGCACGTGTTCCCTTCCTACCAGCCTGTGGGTCCGAAGCAGTACCCTTACA
ATAATCTGTACCTGGAGCGGGGTGGTGATCCTACCAAAGAGCCTGAGCCCGTGGTTCACTATGATATCTG
A


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_026061
Insert Size 561 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_026061.2, NP_080337.1
RefSeq Size 641 bp
RefSeq ORF 561 bp
Locus ID 67264
UniProt ID Q9D6J5
Cytogenetics 19 C3
Summary Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), that is believed not to be involved in catalysis. Complex I functions in the transfer of electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Ndufb8 (NM_026061) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG201748 Ndufb8 (tGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 beta subcomplex 8 (Ndufb8) 10 ug
$500.00
MR201748 Ndufb8 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 beta subcomplex 8 (Ndufb8), nuclear gene encoding mitochondrial protein 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR201748L3 Lenti ORF clone of Ndufb8 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 beta subcomplex 8 (Ndufb8), nuclear gene encoding mitochondrial protein 10 ug
$600.00
MR201748L4 Lenti ORF clone of Ndufb8 (mGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 beta subcomplex 8 (Ndufb8), nuclear gene encoding mitochondrial protein 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.