Chordc1 (NM_025844) Mouse Untagged Clone

CAT#: MC210455

Chordc1 (untagged) - Mouse cysteine and histidine-rich domain (CHORD)-containing, zinc-binding protein 1 (Chordc1), (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Chordc1 (NM_025844) Mouse Untagged Clone
Symbol Chordc1
Synonyms 1110001O09Rik; AA409036; Chp-1; morgana
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC210455 representing NM_025844
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGCTCTTGTGTTACAACCGCGGCTGTGGCCAGCGTTTCGACCCAGAGGCCAACTCGGACGATGCTT
GCACATACCACCCAGGTGTTCCTGTCTTTCATGATGCCCTAAAGGGTTGGTCTTGCTGTAAAAGAAGGAC
AACTGATTTCTCTGACTTCTTAAGCATTGTAGGCTGTACAAAAGGTAGGCATAATAGTGAGAAGCCACCT
GAACCGGTCAAGCCTGAAGTCAAGACTACTGAGAAGAAGGAACTATCTGAATTAAAACCCAAATTTCAGG
AGCACATCATTCAAGCCCCTAAGCCAGTAGAAGCAATAAAAAGGCCAAGCCCAGATGAGCCAATGACAAA
CTTGGAGTTAAAAATATCTGCTTCCCTAAAACAAGCACTTGATAAACTTAAACTGTCATCTGGGAGTGAA
GAAGATAAAAAAGAAGAAGACAGTGATGAAATTAAGATTGGGACTTCCTGTAAAAATGGAGGGTGTTCAA
AGACATACCAGGGTCTACAGAGTCTAGAAGAAGTCTGTGTATATCATTCTGGAGTACCTATTTTCCACGA
GGGGATGAAATATTGGAGCTGTTGTAGAAGAAAAACTTCAGATTTTAATACATTCTTAGCCCAAGAGGGC
TGTACAAGAGGGAAGCATGTATGGACTAAAAAAGATGCAGGGAAAAAAGTTGTTCCGTGTAGACACGACT
GGCATCAGACTGGGGGTGAAGTTACCATCTCAGTGTATGCTAAAAATTCCCTGCCAGAACTCAGTCAAGT
AGAAGCCAACAGTACTTTGTTAAATGTACACATTGTATTTGAAGGAGAGAAAGAATTTCATCAAAATGTG
AAACTGTGGGGTGTAATTGATGTTAAACGAAGTTATGTAACTATGACTGCAACAAAGATTGAGATCACTA
TGAGAAAGGCGGAACCCATGCAGTGGGCAAGTCTTGAACTACCTACAACCAAAAAGCAGGAGAAACAAAA
AGATATAGCTGATTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_025844
ORF Size 996 bp
Insert Size 996
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_025844.2, NP_080120
RefSeq Size 2205
RefSeq ORF 996
Locus ID 66917
Cytogenetics 9|9 A2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.