Ccnh (NM_023243) Mouse Untagged Clone

SKU
MC210415
Ccnh (untagged) - Mouse cyclin H (Ccnh), (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ccnh
Synonyms 6330408H09Rik; AI661354; AV102684; AW538719
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC210415 representing NM_023243
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTATCACAGCAGCAGCCAGAAACGGCACTGGACCTTCGCTAGCGAGGAGCAGCTGGCGCGCCTGCGGG
CGGACGCCAACCGCAAATTCAAGTGCAAAGCTGTGGCTAACGGGAAGGTTCTTCCAAATGATCCAGTGTT
TCTGGAGCCTCATGAAGAATTGACACTTTGCAAGTACTATGAAAAAAGATTATTGGAATTCTGTTCAGTG
TTTAAACCAGCTATGCCACGGTCTGTTGTGGGTACAGCTTGTATGTATTTCAAGCGTTTTTATCTTAATA
ACTCAGTAATGGAATATCACCCTCGGATAATAATGCTTACTTGTGCATTTTTGGCCTGCAAAGTAGATGA
ATTCAATGTGTCTAGTCCCCAGTTTGTTGGAAATCTTCGAGAGAGTCCTCTTGGACAGGAGAGGGCACTG
GAACAGATTTTGGAATATGAACTACTACTTATACAACAACTTAATTTTCACCTTATTGTCCACAATCCAT
ACAGACCATTTGAAGGCTTCCTCATCGATATAAAGACTCGGTACCCCATGTTGGAGAATCCGGAGATTCT
GAGGAAAACAGCTGATGATTTTCTTAGTAGAATTGCATTGACAGATGCTTATCTTTTATACACACCTTCA
CAGATTGCCCTGACCGCCATTTTATCAAGTGCCTCTAGAGCTGGAATTACTATGGAAAGCTACTTATCAG
AGAGTCTAATGCTAAAAGAAAACAGAACTTGCCTGTCACAGTTACTGGATATAATGAAAAGCATGAGAAA
TCTAGTAAAAAAGTACGAGCCGCCCAGGTCTGACGAGGTTGCTGTCCTGAAACAGAAGCTGGAGCGGTGT
CATTCTTCTGACCTTGCACTTAATGCGGTTACGAAGAAGAGGAAAGGCTATGAAGATGATGACTATGTGT
CAAAGAAACCCAAACAGGAAGAGGAGGAATGGACTGATGACGACCTGGTAGATTCTCTCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_023243
Insert Size 972 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_023243.5, NP_075732.1
RefSeq Size 1976 bp
RefSeq ORF 972 bp
Locus ID 66671
UniProt ID Q61458
Cytogenetics 13 C3
Summary Regulates CDK7, the catalytic subunit of the CDK-activating kinase (CAK) enzymatic complex. CAK activates the cyclin-associated kinases CDK1, CDK2, CDK4 and CDK6 by threonine phosphorylation. CAK complexed to the core-TFIIH basal transcription factor activates RNA polymerase II by serine phosphorylation of the repetitive C-terminal domain (CTD) of its large subunit (POLR2A), allowing its escape from the promoter and elongation of the transcripts. Involved in cell cycle control and in RNA transcription by RNA polymerase II. Its expression and activity are constant throughout the cell cycle.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a).
Write Your Own Review
You're reviewing:Ccnh (NM_023243) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MR204705 Ccnh (Myc-DDK-tagged) - Mouse cyclin H (Ccnh) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR204705L3 Lenti ORF clone of Ccnh (Myc-DDK-tagged) - Mouse cyclin H (Ccnh) 10 ug
$600.00
MR204705L4 Lenti ORF clone of Ccnh (mGFP-tagged) - Mouse cyclin H (Ccnh) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.