Retnla (NM_020509) Mouse Untagged Clone
Product Data | |
Type | Mouse Untagged Clone |
---|---|
Target Symbol | Retnla |
Synonyms | 1810019L16Rik; Fizz-1; Fizz1; HIMF; RELM-alpha; RELMa; RELMalpha; Xcp2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>MC210127 representing NM_020509
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGTATAAAAGCATCTCATCTGGCCAGGTCCTGGAACCTTTCCTGAGATTCTGCCCCAGGATGCCAA CTTTGAATAGGATGAAGACTACAACTTGTTCCCTTCTCATCTGCATCTCCCTGCTCCAGCTGATGGTCCC AGTGAATACTGATGAGACCATAGAGATTATCGTGGAGAATAAGGTCAAGGAACTTCTTGCCAATCCAGCT AACTATCCCTCCACTGTAACGAAGACTCTCTCTTGCACTAGTGTCAAGACTATGAACAGATGGGCCTCCT GCCCTGCTGGGATGACTGCTACTGGGTGTGCTTGTGGCTTTGCCTGTGGATCTTGGGAGATCCAGAGTGG AGATACTTGCAACTGCCTGTGCTTACTCGTTGACTGGACCACTGCCCGCTGCTGCCAACTGTCCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_020509 |
Insert Size | 417 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_020509.3, NP_065255.2 |
RefSeq Size | 598 bp |
RefSeq ORF | 417 bp |
Locus ID | 57262 |
UniProt ID | Q9EP95 |
Cytogenetics | 16 30.75 cM |
Summary | Probable hormone. Plays a role in pulmonary vascular remodeling.[UniProtKB/Swiss-Prot Function] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
MG226091 | Retnla (tGFP-tagged) - Mouse resistin like alpha (Retnla), (10ug) | 10 ug |
$365.00
|
|
MR226091 | Retnla (Myc-DDK-tagged) - Mouse resistin like alpha (Retnla) | 10 ug |
$165.00
|
|
MR226091L1 | Lenti ORF clone of Retnla (Myc-DDK-tagged) - Mouse resistin like alpha (Retnla) | 10 ug |
$465.00
|
|
MR226091L2 | Lenti ORF clone of Retnla (mGFP-tagged) - Mouse resistin like alpha (Retnla) | 10 ug |
$465.00
|
|
MR226091L3 | Lenti ORF clone of Retnla (Myc-DDK-tagged) - Mouse resistin like alpha (Retnla) | 10 ug |
$465.00
|
|
MR226091L4 | Lenti ORF clone of Retnla (mGFP-tagged) - Mouse resistin like alpha (Retnla) | 10 ug |
$465.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.