Rnasek (NM_173742) Mouse Untagged Clone

SKU
MC209923
Rnasek (untagged) - Mouse ribonuclease, RNase K (Rnasek), (10ug)
$165.00
2 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Rnasek
Synonyms 2310033H11Rik; AA571397; D11Bwg0434e
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209923 representing NM_173742
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGTCGCTCCTGTGCTGTGGGCCTAAGCTGGCCGCCTGTGGCATCGTCCTCAGCGCCTGGGGAGTGA
TCATGTTGATAATGCTCGGGATATTTTTCAATGTCCATTCTGCTGTGTTAATTGAGGACGTTCCCTTCAC
AGAGAAAGATTTTGAGAACGGTCCTCAGAACATATACAACCTGTACGAGCAAGTCAGCTACAACTGTTTC
ATCGCCGCGGGCCTCTACCTCCTCCTCGGAGGCTTCTCCTTCTGCCAAGTTCGTCTCAACAAGCGCAAGG
AATACATGGTGCGCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_173742
Insert Size 297 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_173742.3, NP_776103.1
RefSeq Size 622 bp
RefSeq ORF 297 bp
Locus ID 52898
UniProt ID Q8K3C0
Cytogenetics 11 42.99 cM
Summary Endoribonuclease which preferentially cleaves ApU and ApG phosphodiester bonds. Hydrolyzes UpU bonds at a lower rate (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Rnasek (NM_173742) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG200295 Rnasek (tGFP-tagged) - Mouse DNA segment, Chr 11, Brigham & Women's Genetics 0434 expressed (D11Bwg0434e) 10 ug
$350.00
MR200295 Rnasek (Myc-DDK-tagged) - Mouse ribonuclease, RNase K (Rnasek) 10 ug
$289.00
MR200295L3 Lenti ORF clone of Rnasek (Myc-DDK-tagged) - Mouse ribonuclease, RNase K (Rnasek) 10 ug
$450.00
MR200295L4 Lenti ORF clone of Rnasek (mGFP-tagged) - Mouse ribonuclease, RNase K (Rnasek) 10 ug
$450.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.