Prok2 (NM_015768) Mouse Untagged Clone

SKU MC209851

Prok2 (untagged) - Mouse prokineticin 2 (Prok2), transcript variant 1, (10ug)

Product Data

• Type: Mouse Untagged Clone
• Target Symbol: Prok2
• Synonyms: Bv8; PK2; Prok1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209851 representing NM_015768; Red=Cloning site Blue=ORF Orange=Stop codon; ; TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC; GCCGCGATCGCC; ; ATGGGGGACCCGCGCTGTGCCCCGCTACTGCTACTTCTGCTGCTACCGCTGCTGTTCACACCGCCCGCCG; GGGATGCCGCGGTCATCACCGGGGCTTGCGACAAGGACTCTCAGTGCGGAGGAGGCATGTGCTGTGCTGT; CAGTATCTGGGTTAAGAGCATAAGGATCTGCACACCTATGGGCCAAGTGGGCGACAGCTGCCACCCCCTG; ACTCGGAAAAGTCATGTTGCAAATGGAAGGCAGGAAAGAAGAAGGGCGAAGAGAAGAAAGAGGAAGAAGG; AGGTTCCATTTTGGGGGCGGAGGATGCACCACACCTGCCCCTGCCTGCCAGGCTTGGCGTGTTTAAGGAC; TTCTTTCAACCGGTTTATTTGCTTGGCCCGGAAATGA; ; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT; ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_015768
• Insert Size: 387 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_015768.2, NP_056583.1
• RefSeq Size: 1513 bp
• RefSeq ORF: 387 bp
• Locus ID: 50501
• UniProt ID: Q9QXU7
• Cytogenetics: 6 46.29 cM
• Summary: May function as an output molecule from the suprachiasmatic nucleus (SCN) that transmits behavioral circadian rhythm. May also function locally within the SCN to synchronize output. Potently contracts gastrointestinal (GI) smooth muscle (By similarity).[UniProtKB/Swiss-Prot Function]; Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.