Spo11 (NM_012046) Mouse Untagged Clone

SKU
MC209757
Spo11 (untagged) - Mouse sporulation protein, meiosis-specific, SPO11 homolog (S. cerevisiae) (Spo11), transcript variant 1, (10ug)
$686.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Spo11
Synonyms AI449549; Spo11a; Spo11b
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209757 representing NM_012046
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGTTCGCGCCTATGGGGCCCGAGGCCTCGTTCTTCGACGCCCTGGATCGGCACAGGGCTTCCCTGT
TGGCCATGGTGAAGAGAGGCGCAGGGGAGACCCCTGCCGGGGCCACCCGCGTGGCCTCTAGTTCTGAGGT
TCTTACAGCTATAGAAAATATTATCCAAGACATAATCAAAAGCTTGGCAAGAAATGAAGTGCCTGCCTTC
ACAATAGACAACAGATCGAGCTGGGAAAACATAATGTTTGATGATTCTGTCGGCCTTCGGATGATACCTC
AGTGTACCACAAGAAAAATCAGAAGCGATTCACCAAAATCAGTTAAGAAATTCGCTCTGATTCTGAAAGT
ATTGTCCATGATTTATAAATTAATACAGAGCGACACTTATGCAACCAAGAGAGACATATACTACACTGAC
AGCCAGCTCTTTGGGAACCAGGCTGCGGTGGACAGCGCCATCGATGACATTTCCTGTATGCTGAAAGTGC
CCAGGAGGAGTCTGCACGTGCTATCTACTTCCAAGGGATTGATTGCTGGCAACTTGAGATACATGGAGGA
AGATGGTACCAGAGTCCAGTGTACCTGTAGTGCCACGGCTACTGCTGTGCCGACTAACATTCAAGGAATG
CAGCATCTGATCACAGATGCGAAGTTTCTGTTAATAGTCGAGAAGGATGCAACATTTCAGCGGCTCCTGG
ACGACAACTTCTGCAGCAGGATGTCCCCGTGCATCATGGTTACGGGAAAGGGCGTTCCAGATCTGAACAC
GAGGCTCTTGGTAAAGAAGCTGTGGGACACCTTTCATATTCCTGTTTTCACACTGGTCGATGCAGATCCC
TACGGCATCGAGATAATGTGCATCTATAAGTACGGATCCATGTCCATGTCTTTTGAAGCTCACAATCTCA
CTATCCCAACAATCAGATGGCTTGGTCTCCTCCCTTCTGATATCCAGAGGTTAAATATACCTAAGGATAG
TTTGATCCCACTGACAAAGCATGACCAGATGAAGCTGGACAGCATCCTGAAGAGGCCTTACATTACCTAC
CAGCCCCTCTGGAAAAAAGAGCTGGAGATGATGGCAGACTCTAAGATGAAGGCAGAGATCCAAGCCTTGA
CCTTGCTGTCGTCAGACTACCTGTCCAGAGTGTACTTACCCAACAAGCTGAGGTTTGGAGGATGGATCTA
A


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI
ACCN NM_012046
Insert Size 1191 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_012046.2, NP_036176.1
RefSeq Size 1716 bp
RefSeq ORF 1191 bp
Locus ID 26972
UniProt ID Q9WTK8
Cytogenetics 2 95.64 cM
Summary Isoform 1: Component of a topoisomerase 6 complex specifically required for meiotic recombination. Together with TOP6BL, mediates DNA cleavage that forms the double-strand breaks (DSB) that initiate meiotic recombination (PubMed:26917764). The complex promotes relaxation of negative and positive supercoiled DNA and DNA decatenation through cleavage and ligation cycles. Essential for the phosphorylation of SMC3, HORMAD1 and HORMAD2 (PubMed:22346761).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a).
Write Your Own Review
You're reviewing:Spo11 (NM_012046) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG226168 Spo11 (tGFP-tagged) - Mouse sporulation protein meiosis-specific SPO11 homolog (S. cerevisiae) (Spo11) transcript variant 1, (10ug) 10 ug
$886.00
MR226168 Spo11 (Myc-DDK-tagged) - Mouse sporulation protein, meiosis-specific, SPO11 homolog (S. cerevisiae) (Spo11), transcript variant 1 10 ug
$686.00
MR226168L3 Lenti ORF clone of Spo11 (Myc-DDK-tagged) - Mouse sporulation protein, meiosis-specific, SPO11 homolog (S. cerevisiae) (Spo11), transcript variant 1 10 ug
$986.00
MR226168L4 Lenti ORF clone of Spo11 (mGFP-tagged) - Mouse sporulation protein, meiosis-specific, SPO11 homolog (S. cerevisiae) (Spo11), transcript variant 1 10 ug
$986.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.