Oas1b (NM_001083925) Mouse Untagged Clone

SKU
MC209687
Oas1b (untagged) - Mouse 2'-5' oligoadenylate synthetase 1B (Oas1b), (10ug)
$503.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Oas1b
Synonyms F; Flv; L; L1; Mmu-L; Mmu-L1; O; Oas1; Oi; Oias-2; Oias2; W; Wnv
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209687 representing NM_001083925
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGCAGGATCTGAGGAGCATCCCGGCCTCGAAGCTTGATAAGTTCATAGAGAACCATCTCCCGGACA
CCAGCTTCTGTGCTGACCTCAGAGAAGTCATAGATGCCCTGTGTGCTCTCCTGAAGGACAGATCCTTCCG
GGGCCCCGTCCGCCGAATGAGGGCCTCTAAAGGGGTCAAGGGCAAAGGCACCACACTCAAGGGCAGGTCA
GACGCTGACCTGGTGGTGTTCCTTAACAATCTCACCAGCTTTGAGGATCAGTTAAACCAACAGGGAGTGT
TGATTAAGGAAATTAAGAAACAGCTGTGCGAGGTTCAGCATGAGAGACGTTGTGGAGTGAAGTTTGAGGT
CCACAGTTTAAGGAGTCCCAACTCCCGGGCTCTGAGCTTCAAGCTGAGCGCCCCCGACCTGCTGAAGGAG
GTGAAGTTTGATGTGCTGCCAGCCTATGATTTACTGGATCATCTTAACATCCTCAAGAAGCCTAACCAAC
AATTCTACGCCAATCTCATCAGTGGGCGTACCCCGCCGGGGAAGGAGGGCAAGTTATCGATCTGCTTTAT
GGGGCTTCGGAAGTACTTCCTGAACTGTCGCCCAACCAAGCTGAAGCGCCTCATCCGCCTGGTCACGCAC
TGGTACCAACTGTGTAAGGAGAAGCTGGGGGACCCGCTGCCCCCACAGTATGCCCTGGAGCTGCTCACAG
TCTATGCCTGGGAGTATGGGAGTCGAGTAACTAAATTCAACACAGCCCAGGGCTTCCGAACCGTCTTGGA
ACTGGTCACCAAGTACAAACAGCTTCGAATCTACTGGACAGTGTATTATGACTTTCGACATCAAGAGGTC
TCTGAATACCTGCACCAACAGCTCAAAAAAGACAGGCCTGTGATCTTGGACCCCGCTGACCCAACAAGGA
ACATAGCTGGTTTGAACCCAAAGGACTGGCGGCGTCTAGCAGGAGAGGCTGCCACCTGGCTGCAATACCC
ATGCTTTAAGTACAGGGACGGTTCCCCAGTGTGCTCCTGGGAGGTGCCGACGGAGGTTGGAGTGCCAATG
AAGTATCTCTTTTGTCGTATTTTCTGGTTATTGTTTTGGTCTTTGTTTCATTTCATCTTTGGGAAGACTT
CATCTGGATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_001083925
Insert Size 1131 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001083925.1, NP_001077394.1
RefSeq Size 1837 bp
RefSeq ORF 1131 bp
Locus ID 23961
UniProt ID Q60856
Cytogenetics 5 60.64 cM
Summary This gene is a member of the 2'-5' oligoA synthetase family, which are clustered on chromosome 5. The encoded protein functions in the interferon-regulated OAS/RNase L system, which mediates RNA decay as part of the innate antiviral immunity pathway. The protein binds double-stranded RNA and oligomerizes ATP, which activate the single-stranded RNA cleavage enzyme RNase L. This protein mediates resistance to flaviviruses such as West Nile virus. The majority of wild mouse strains produce a functional protein and are resistant to flavivirus infection, whereas some inbred mouse strains including the strain of the reference genome, C57BL/6J, contain a premature stop codon that inactivates this gene product. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1, coding) represents the functional allele that is not present in some strains, including the strain of the reference genome. Sequence Note: This RefSeq record was created to represent the transcript and the full-length, functional protein that is expressed in several strains. It does not contain a premature stop codon that truncates the coding region of several strains, including the strain of the reference genome, C57BL/6J.
Write Your Own Review
You're reviewing:Oas1b (NM_001083925) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG220810 Oas1b (tGFP-tagged) - Mouse 2'-5' oligoadenylate synthetase 1B (Oas1b), (10ug) 10 ug
$657.00
MR220810 Oas1b (Myc-DDK-tagged) - Mouse 2'-5' oligoadenylate synthetase 1B (Oas1b) 10 ug
$289.00 MSRP $457.00 MSRP $457.00
MR220810L3 Lenti ORF clone of Oas1b (Myc-DDK-tagged) - Mouse 2'-5' oligoadenylate synthetase 1B (Oas1b) 10 ug
$757.00
MR220810L4 Lenti ORF clone of Oas1b (mGFP-tagged) - Mouse 2'-5' oligoadenylate synthetase 1B (Oas1b) 10 ug
$757.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.