Uchl1 (NM_011670) Mouse Untagged Clone

SKU
MC209614
Uchl1 (untagged) - Mouse ubiquitin carboxy-terminal hydrolase L1 (Uchl1), (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Uchl1
Synonyms AW822034; C88048; gad; PGP 9.5; PGP9.5; R75593; UCH-L1; UCHL-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209614 representing NM_011670
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGCTGAAGCCGATGGAGATTAACCCCGAGATGCTGAACAAAGTGTTGGCCAAGCTGGGGGTCGCCG
GCCAGTGGCGCTTCGCCGACGTGCTAGGGCTGGAGGAGGAGACTCTGGGCTCAGTGCCATCCCCTGCCTG
CGCCCTGCTGCTCCTGTTTCCCCTCACGGCCCAGCATGAAAACTTCAGGAAAAAGCAAATTGAGGAACTG
AAGGGACAGGAAGTTAGCCCTAAAGTTTACTTCATGAAGCAGACCATCGGAAACTCCTGTGGTACCATCG
GGTTGATCCACGCAGTGGCCAACAACCAAGACAAGCTGGAATTTGAGGATGGATCCGTCCTGAAACAGTT
TCTGTCTGAAACGGAGAAGCTGTCCCCCGAAGATAGAGCCAAGTGTTTCGAGAAGAACGAGGCCATCCAG
GCGGCCCATGACTCCGTGGCCCAGGAGGGCCAGTGTCGGGTAGATGACAAAGTGAATTTCCATTTTATTC
TGTTCAACAACGTGGACGGCCATCTGTACGAGCTCGATGGGCGAATGCCCTTTCCAGTGAACCATGGCGC
CAGCTCAGAGGACTCTCTGCTGCAGGATGCTGCCAAGGTCTGCAGAGAATTCACTGAGCGCGAGCAGGGG
GAGGTCCGCTTCTCTGCCGTGGCTCTCTGCAAAGCAGCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_011670
Insert Size 672 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_011670.2, NP_035800.2
RefSeq Size 1156 bp
RefSeq ORF 672 bp
Locus ID 22223
UniProt ID Q9R0P9
Cytogenetics 5 35.95 cM
Summary Ubiquitin-protein hydrolase involved both in the processing of ubiquitin precursors and of ubiquitinated proteins (Probable). This enzyme is a thiol protease that recognizes and hydrolyzes a peptide bond at the C-terminal glycine of ubiquitin (PubMed:12913066). Also binds to free monoubiquitin and may prevent its degradation in lysosomes (PubMed:12913066). The homodimer may have ATP-independent ubiquitin ligase activity (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Uchl1 (NM_011670) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG202576 Uchl1 (tGFP-tagged) - Mouse ubiquitin carboxy-terminal hydrolase L1 (Uchl1) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
MR202576 Uchl1 (Myc-DDK-tagged) - Mouse ubiquitin carboxy-terminal hydrolase L1 (Uchl1) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR202576L3 Lenti ORF clone of Uchl1 (Myc-DDK-tagged) - Mouse ubiquitin carboxy-terminal hydrolase L1 (Uchl1) 10 ug
$600.00
MR202576L4 Lenti ORF clone of Uchl1 (mGFP-tagged) - Mouse ubiquitin carboxy-terminal hydrolase L1 (Uchl1) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.