Tgfb3 (NM_009368) Mouse Untagged Clone

SKU
MC209523
Tgfb3 (untagged) - Mouse transforming growth factor, beta 3 (Tgfb3), (10ug)
$686.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Tgfb3
Synonyms TGF-beta-3; Tgfb-3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209523 representing NM_009368
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGATGCACTTGCAAAGGGCTCTGGTAGTCCTGGCCCTGCTGAACTTGGCCACAATCAGCCTCTCTC
TGTCCACTTGCACCACGTTGGACTTCGGCCACATCAAGAAGAAGAGGGTGGAAGCCATTAGGGGACAGAT
CTTGAGCAAGCTCAGGCTCACCAGCCCCCCTGAGCCATCGGTGATGACCCACGTCCCCTATCAGGTCCTG
GCACTTTACAACAGCACCCGGGAGTTGCTGGAAGAGATGCACGGGGAGAGGGAGGAAGGCTGCACTCAGG
AGACCTCGGAGTCTGAGTACTATGCCAAAGAGATCCATAAATTCGACATGATCCAGGGACTGGCGGAGCA
CAATGAACTGGCCGTCTGCCCCAAAGGAATTACCTCTAAGGTTTTTCGTTTCAATGTGTCCTCAGTGGAG
AAAAATGGAACCAATCTGTTCCGGGCAGAGTTCCGGGTCTTGCGGGTGCCCAACCCCAGCTCCAAGCGCA
CAGAGCAGAGAATTGAGCTCTTCCAGATACTTCGACCGGATGAGCACATAGCCAAGCAGCGCTACATAGG
TGGCAAGAATCTGCCCACAAGGGGCACCGCTGAATGGCTGTCTTTCGATGTCACTGACACTGTGCGCGAG
TGGCTGTTGAGGAGAGAGTCCAACTTGGGTCTGGAAATCAGCATCCACTGTCCATGTCACACCTTTCAGC
CCAATGGAGACATACTGGAAAATGTTCATGAGGTGATGGAAATCAAATTCAAAGGAGTGGACAATGAAGA
TGACCATGGCCGTGGAGACCTGGGGCGTCTCAAGAAGCAAAAGGATCACCACAACCCACACCTGATCCTC
ATGATGATCCCCCCACACCGACTGGACAGCCCAGGCCAGGGCAGTCAGAGGAAGAAGAGGGCCCTGGACA
CCAATTACTGCTTCCGCAACCTGGAGGAGAACTGCTGTGTACGCCCCCTTTATATTGACTTCCGGCAGGA
TCTAGGCTGGAAATGGGTCCACGAACCTAAGGGTTACTATGCCAACTTCTGCTCAGGCCCTTGCCCATAC
CTCCGCAGCGCAGACACAACCCATAGCACGGTGCTTGGACTATACAACACCCTGAACCCAGAGGCGTCTG
CCTCGCCATGCTGCGTCCCCCAGGACCTGGAGCCCCTGACCATCTTGTACTATGTGGGCAGAACCCCCAA
GGTGGAGCAGCTGTCCAACATGGTGGTGAAGTCGTGTAAGTGCAGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI
ACCN NM_009368
Insert Size 1239 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_009368.3, NP_033394.2
RefSeq Size 3401 bp
RefSeq ORF 1239 bp
Locus ID 21809
Cytogenetics 12 40.09 cM
Summary This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. This protein is involved in embryogenesis and cell differentiation, and may play a role in wound healing. Homozygous knockout mice for this gene exhibit cleft palate, delayed pulmonary development and neonatal death. [provided by RefSeq, Aug 2016]
Write Your Own Review
You're reviewing:Tgfb3 (NM_009368) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG206441 Tgfb3 (tGFP-tagged) - Mouse transforming growth factor, beta 3 (Tgfb3) 10 ug
$886.00
MR206441 Tgfb3 (Myc-DDK-tagged) - Mouse transforming growth factor, beta 3 (Tgfb3) 10 ug
$686.00
MR206441L3 Lenti ORF clone of Tgfb3 (Myc-DDK-tagged) - Mouse transforming growth factor, beta 3 (Tgfb3) 10 ug
$986.00
MR206441L4 Lenti ORF clone of Tgfb3 (mGFP-tagged) - Mouse transforming growth factor, beta 3 (Tgfb3) 10 ug
$986.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.