Sstr2 (NM_001042606) Mouse Untagged Clone

SKU
MC209420
Sstr2 (untagged) - Mouse somatostatin receptor 2 (Sstr2), transcript variant 1, (10ug)
$457.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Sstr2
Synonyms Smstr-2; Smstr2; SRIF-1; SS2R; sst2; SSTR-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209420 representing NM_001042606
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGATGAGCTCTGAGCAGTTGAATGGGAGCCAAGTGTGGGTGTCCTCTCCATTTGACCTCAACGGCT
CACTGGGGCCAAGCAATGGCTCCAACCAGACCGAGCCATACTACGACATGACAAGCAACGCCGTCCTCAC
GTTCATCTACTTCGTGGTGTGTGTTGTCGGGCTGTGCGGCAACACGCTGGTCATTTATGTCATCCTCCGC
TATGCCAAGATGAAGACCATCACCAACATCTACATCCTTAACCTGGCCATTGCAGATGAACTCTTCATGC
TAGGGCTGCCCTTCTTGGCCATGCAGGTGGCGCTAGTCCACTGGCCTTTTGGCAAGGCCATCTGCCGGGT
GGTCATGACTGTAGATGGCATCAATCAGTTCACCAGTATCTTCTGCTTGACGGTCATGAGCATCGACCGC
TACCTGGCCGTGGTGCACCCCATTAAGTCAGCCAAATGGAGGCGACCCCGGACAGCCAAGATGATCAATG
TAGCTGTGTGGTGTGTGTCTCTGCTCGTCATTTTGCCCATCATGATATACGCCGGCCTCCGGAGCAACCA
GTGGGGCAGGAGCAGCTGTACCATCAACTGGCCAGGCGAATCCGGGGCGTGGTACACAGGTTTCATTATC
TACGCCTTCATCCTGGGGTTCCTGGTACCCCTTACCATCATTTGTCTCTGCTACCTGTTCATCATCATCA
AGGTGAAGTCCTCTGGAATCCGAGTGGGATCATCCAAGAGGAAAAAGTCAGAGAAAAAGGTGACCCGCAT
GGTGTCCATCGTAGTGGCTGTCTTCATCTTCTGCTGGCTCCCCTTCTACATCTTCAACGTCTCTTCCGTG
TCTGTGGCCATCAGTCCCACCCCAGCCCTGAAAGGCATGTTTGACTTTGTGGTGATCCTCACCTATGCCA
ACAGCTGCGCCAACCCCATCCTGTACGCCTTCTTGTCTGACAACTTCAAGAAGAGCTTCCAGAATGTTCT
TTGCTTGGTCAAGGTGAGTGGTACGGAGGATGGGGAGAGGAGCGACAGTAAGCAGGACAAATCCCGGCTG
AATGAGACCACGGAGACCCAGAGGACCCTCCTCAATGGAGACCTCCAAACCAGTATCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI
ACCN NM_001042606
Insert Size 1110 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001042606.2, NP_001036071.1
RefSeq Size 1342 bp
RefSeq ORF 1110 bp
Locus ID 20606
UniProt ID P30875
Cytogenetics 11 79.05 cM
Summary The protein encoded by this gene is a receptor for somatostatin, which acts at many sites to inhibit the release of several hormones and other secretory proteins. The encoded protein is a member of the superfamily of receptors having seven transmembrane segments and is involved in many processes, including adenylyl cyclase inhibition, phosphotyrosine phosphatase stimulation, and inhibition of calcium entry and cell growth. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (1) lacks an exon and its transcription extends past a splice site that is used in variant 2. This results in a novel 3' coding region and 3' UTR, compared to variant 2. It encodes isoform A which is longer and has a distinct C-terminus, compared to isoform B.
Write Your Own Review
You're reviewing:Sstr2 (NM_001042606) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG225097 Sstr2 (tGFP-tagged) - Mouse somatostatin receptor 2 (Sstr2) transcript variant 1, (10ug) 10 ug
$886.00
MR225097 Sstr2 (Myc-DDK-tagged) - Mouse somatostatin receptor 2 (Sstr2), transcript variant 1 10 ug
$686.00
MR225097L3 Lenti ORF clone of Sstr2 (Myc-DDK-tagged) - Mouse somatostatin receptor 2 (Sstr2), transcript variant 1 10 ug
$986.00
MR225097L4 Lenti ORF clone of Sstr2 (mGFP-tagged) - Mouse somatostatin receptor 2 (Sstr2), transcript variant 1 10 ug
$986.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.