Slc10a1 (NM_011387) Mouse Untagged Clone
SKU
MC209412
Slc10a1 (untagged) - Mouse solute carrier family 10 (sodium/bile acid cotransporter family), member 1 (Slc10a1), transcript variant 2, (10ug)
Product Data | |
Type | Mouse Untagged Clone |
---|---|
Target Symbol | Slc10a1 |
Synonyms | Ntcp |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>MC209412 representing NM_011387
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGGCGCACAACGTATCAGCCCCCTTCAATTTCTCCCTGCCGCCTGGCTTTGGCCACCGGGCCACAG ACACTGCGCTCAGCGTCATTCTGGTAGTTATGTTGCTGCTCATCATGCTCTCGCTTGGCTGCACCATGGA GTTCAGCAAGATCAAGGCTCACTTCTGGAAGCCCAAAGGGGTGATCATCGCCATAGTGGCCCAGTACGGT ATCATGCCCCTCAGTGCTTTCCTTCTGGGCAAGGTCTTTCATCTGACCAGCATTGAGGCTCTGGCCATCC TCATCTGCGGCTGCTCTCCTGGGGGGAACCTGTCTAACCTCTTCACCCTGGCCATGAAGGGGGACATGAA CCTCAGCATTGTGATGACCACCTGCTCCAGCTTCACTGCCTTGGGCATGATGCCTCTCCTCTTATACATC TACAGCAAAGGAATCTACGACGGAGATCTTAAGGACAAGGTGCCCTACAAAGGCATTATGTTATCACTCG TCATGGTTCTCATTCCTTGCGCCATAGGGATCTTCCTGAAGTCCAAAAGGCCACACTATGTACCCTACGT CCTCAAGGCAGGCATGATCATCACTTTCTCCCTCTCTGTGGCTGTCACAGTCCTGTCTGTCATCAATGTG GGCAACAGCATCATGTTCGTCATGACACCACACTTACTGGCTACCTCCTCCCTGATGCCTTTCACTGGCT TCCTGATGGGCTACATTCTCTCTGCTCTCTTCCGACTAAATCCAAGCTGCAGACGCACCATCAGCATGGA AACAGGATTCCAAAACGTCCAACTCTGTTCTACCATCCTCAATGTCACCTTCCCCCCTGAAGTCATTGGA CCACTGTTCTTCTTTCCTCTCCTTTATATGATTTTTCAGCTTGCAGAAGGACTTCTCTTCATTATTATCT TCCGGTGCTATTTGAAAATCAAACCTCAGAAGGGTAAGTATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_011387 |
Insert Size | 954 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_011387.2, NP_035517.1 |
RefSeq Size | 1506 bp |
RefSeq ORF | 954 bp |
Locus ID | 20493 |
Cytogenetics | 12 37.21 cM |
Summary | The hepatic sodium/bile acid uptake system exhibits broad substrate specificity and transports various non-bile acid organic compounds as well. It is strictly dependent on the extracellular presence of sodium.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) contains an alternate segment in the 3' coding region that results in a frameshift and early stop codon compare to variant 1. The resulting protein (isoform 2) has a shorter, distinct C-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
MG225032 | Slc10a1 (tGFP-tagged) - Mouse solute carrier family 10 (sodium/bile acid cotransporter family) member 1 (Slc10a1) transcript variant 2, (10ug) | 10 ug |
$650.00
|
|
MR225032 | Slc10a1 (Myc-DDK-tagged) - Mouse solute carrier family 10 (sodium/bile acid cotransporter family), member 1 (Slc10a1), transcript variant 2 | 10 ug |
$450.00
|
|
MR225032L3 | Lenti ORF clone of Slc10a1 (Myc-DDK-tagged) - Mouse solute carrier family 10 (sodium/bile acid cotransporter family), member 1 (Slc10a1), transcript variant 2 | 10 ug |
$750.00
|
|
MR225032L4 | Lenti ORF clone of Slc10a1 (mGFP-tagged) - Mouse solute carrier family 10 (sodium/bile acid cotransporter family), member 1 (Slc10a1), transcript variant 2 | 10 ug |
$750.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.