Pln (NM_001141927) Mouse Untagged Clone

SKU
MC209191
Pln (untagged) - Mouse phospholamban (Pln), transcript variant 1, (10ug)
$165.00
2 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Pln
Synonyms Plb
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209191 representing NM_001141927
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAAAAGTGCAATACCTCACTCGCTCGGCTATCAGGAGAGCCTCCACTATTGAAATGCCTCAGCAAG
CACGTCAGAATCTCCAGAACCTATTTATCAATTTCTGCCTCATCTTGATATGTCTGCTGCTGATCTGCAT
CATTGTGATGCTTCTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_001141927
Insert Size 159 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001141927.1, NP_001135399.1
RefSeq Size 2480 bp
RefSeq ORF 159 bp
Locus ID 18821
UniProt ID P61014
Cytogenetics 10 B3
Summary Reversibly inhibits the activity of ATP2A2 in cardiac sarcoplasmic reticulum by decreasing the apparent affinity of the ATPase for Ca(2+). Modulates the contractility of the heart muscle in response to physiological stimuli via its effects on ATP2A2. Modulates calcium re-uptake during muscle relaxation and plays an important role in calcium homeostasis in the heart muscle. The degree of ATP2A2 inhibition depends on the oligomeric state of PLN. ATP2A2 inhibition is alleviated by PLN phosphorylation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.
Write Your Own Review
You're reviewing:Pln (NM_001141927) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MR200019 Pln (Myc-DDK-tagged) - Mouse phospholamban (Pln), transcript variant 1 10 ug
$225.00
MR200019L3 Lenti ORF clone of Pln (Myc-DDK-tagged) - Mouse phospholamban (Pln), transcript variant 1 10 ug
$525.00
MR200019L4 Lenti ORF clone of Pln (mGFP-tagged) - Mouse phospholamban (Pln), transcript variant 1 10 ug
$525.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.