Nkx2-5 (NM_008700) Mouse Untagged Clone
SKU
MC209038
Nkx2 (untagged) - Mouse NK2 transcription factor related, locus 5 (Drosophila) (Nkx2-5), (10ug)
Product Data | |
Type | Mouse Untagged Clone |
---|---|
Target Symbol | Nkx2-5 |
Synonyms | Csx; Nkx-2.5; Nkx2.5; tinman |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_008700, the custom clone sequence may differ by one or more nucleotides
ATGTTCCCCAGCCCTGCGCTCACACCCACGCCTTTCTCAGTCAAAGACATCCTGAACCTGGAGCAGCAGC AGCGTAGCCTGGCGTCTGGGGACCTGTCTGCGCGCCTCGAGGCCACCCTGGCCCCTGCCTCCTGCATGCT GGCCGCCTTCAAGCCCGAGGCCTACTCTGGCCCCGAGGCGGCAGCGTCCGGCCTGGCAGAGCTGCGCGCG GAGATGGGCCCCGCGCCTTCGCCCCCCAAGTGCTCTCCTGCTTTCCCAGCCGCCCCCACATTTTACCCGG GAGCCTACGGTGACCCTGACCCAGCCAAAGACCCTCGGGCGGATAAAAAAGAGCTGTGCGCGCTGCAGAA GGCAGTGGAGCTGGACAAAGCCGAGACGGATGGCGCCGAGAGACCACGCGCACGGCGGCGACGGAAGCCA CGCGTGCTCTTCTCGCAGGCGCAGGTCTACGAGCTGGAGCGGCGCTTCAAGCAACAGCGGTACCTGTCGG CGCCAGAGCGCGACCAGCTGGCCAGCGTGCTGAAGCTCACGTCCACGCAGGTCAAGATCTGGTTCCAGAA CCGTCGCTACAAGTGCAAGCGACAGC:GGCAGGACCAGACTCTGGAGCTTCTGGGGCCGCCGCCGCCGCC CGCGCGCAGGATCGCGGTGCCCGTGCTGGTGCGCGACGGGAAGCCCTGCCTGGGGGACCCCGCGGCCTAC GCTCCCGCCTACGGCGTGGGTCTCAATGCCTATGGCTACAACGCCTACCCCTACCCCAGCTACGGCGGCG CGGCCTGCAGTCCCGGCTACAGCTGCGCCGCCTACCCCGCTGCGCCCCCCGCCGCGCAGCCCCCCGCCGC CTCCGCCAACAGCAACTTCGTGAACTTTGGCGTCGGGGACTTGAACACCGTGCAGAGTCCCGGGATGCCG CAGGGCAATTCGGGCGTCTCCACGCTGCACGGCATCCGAGCCTGGTAG |
Restriction Sites | SgfI-RsrII |
ACCN | NM_008700 |
Insert Size | 957 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | BC139299, AAI39300 |
RefSeq Size | 1110 bp |
RefSeq ORF | 957 bp |
Locus ID | 18091 |
UniProt ID | P42582 |
Cytogenetics | 17 13.6 cM |
Summary | Implicated in commitment to and/or differentiation of the myocardial lineage. Acts as a transcriptional activator of ANF in cooperation with GATA4. Binds to the core DNA motif of NPPA promoter. It is transcriptionally controlled by PBX1 and acts as a transcriptional repressor of CDKN2B. Together with PBX1, it is required for spleen development through a mechanism that involves CDKN2B repression.[UniProtKB/Swiss-Prot Function] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
MG227399 | Nkx2 (tGFP-tagged) - Mouse NK2 transcription factor related locus 5 (Drosophila) (Nkx2-5), (10ug) | 10 ug |
$500.00
|
|
MR227399 | Nkx2 (Myc-DDK-tagged) - Mouse NK2 transcription factor related, locus 5 (Drosophila) (Nkx2-5) | 10 ug |
$289.00
MSRP
$300.00
MSRP
$300.00
|
|
MR227399L3 | Lenti ORF clone of Nkx2 (Myc-DDK-tagged) - Mouse NK2 transcription factor related, locus 5 (Drosophila) (Nkx2-5) | 10 ug |
$600.00
|
|
MR227399L4 | Lenti ORF clone of Nkx2 (mGFP-tagged) - Mouse NK2 transcription factor related, locus 5 (Drosophila) (Nkx2-5) | 10 ug |
$600.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.