Nkx2-5 (NM_008700) Mouse Untagged Clone

SKU
MC209038
Nkx2 (untagged) - Mouse NK2 transcription factor related, locus 5 (Drosophila) (Nkx2-5), (10ug)
$300.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Nkx2-5
Synonyms Csx; Nkx-2.5; Nkx2.5; tinman
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_008700, the custom clone sequence may differ by one or more nucleotides


ATGTTCCCCAGCCCTGCGCTCACACCCACGCCTTTCTCAGTCAAAGACATCCTGAACCTGGAGCAGCAGC
AGCGTAGCCTGGCGTCTGGGGACCTGTCTGCGCGCCTCGAGGCCACCCTGGCCCCTGCCTCCTGCATGCT
GGCCGCCTTCAAGCCCGAGGCCTACTCTGGCCCCGAGGCGGCAGCGTCCGGCCTGGCAGAGCTGCGCGCG
GAGATGGGCCCCGCGCCTTCGCCCCCCAAGTGCTCTCCTGCTTTCCCAGCCGCCCCCACATTTTACCCGG
GAGCCTACGGTGACCCTGACCCAGCCAAAGACCCTCGGGCGGATAAAAAAGAGCTGTGCGCGCTGCAGAA
GGCAGTGGAGCTGGACAAAGCCGAGACGGATGGCGCCGAGAGACCACGCGCACGGCGGCGACGGAAGCCA
CGCGTGCTCTTCTCGCAGGCGCAGGTCTACGAGCTGGAGCGGCGCTTCAAGCAACAGCGGTACCTGTCGG
CGCCAGAGCGCGACCAGCTGGCCAGCGTGCTGAAGCTCACGTCCACGCAGGTCAAGATCTGGTTCCAGAA
CCGTCGCTACAAGTGCAAGCGACAGC:GGCAGGACCAGACTCTGGAGCTTCTGGGGCCGCCGCCGCCGCC
CGCGCGCAGGATCGCGGTGCCCGTGCTGGTGCGCGACGGGAAGCCCTGCCTGGGGGACCCCGCGGCCTAC
GCTCCCGCCTACGGCGTGGGTCTCAATGCCTATGGCTACAACGCCTACCCCTACCCCAGCTACGGCGGCG
CGGCCTGCAGTCCCGGCTACAGCTGCGCCGCCTACCCCGCTGCGCCCCCCGCCGCGCAGCCCCCCGCCGC
CTCCGCCAACAGCAACTTCGTGAACTTTGGCGTCGGGGACTTGAACACCGTGCAGAGTCCCGGGATGCCG
CAGGGCAATTCGGGCGTCTCCACGCTGCACGGCATCCGAGCCTGGTAG


Restriction Sites SgfI-RsrII
ACCN NM_008700
Insert Size 957 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC139299, AAI39300
RefSeq Size 1110 bp
RefSeq ORF 957 bp
Locus ID 18091
UniProt ID P42582
Cytogenetics 17 13.6 cM
Summary Implicated in commitment to and/or differentiation of the myocardial lineage. Acts as a transcriptional activator of ANF in cooperation with GATA4. Binds to the core DNA motif of NPPA promoter. It is transcriptionally controlled by PBX1 and acts as a transcriptional repressor of CDKN2B. Together with PBX1, it is required for spleen development through a mechanism that involves CDKN2B repression.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Nkx2-5 (NM_008700) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG227399 Nkx2 (tGFP-tagged) - Mouse NK2 transcription factor related locus 5 (Drosophila) (Nkx2-5), (10ug) 10 ug
$500.00
MR227399 Nkx2 (Myc-DDK-tagged) - Mouse NK2 transcription factor related, locus 5 (Drosophila) (Nkx2-5) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR227399L3 Lenti ORF clone of Nkx2 (Myc-DDK-tagged) - Mouse NK2 transcription factor related, locus 5 (Drosophila) (Nkx2-5) 10 ug
$600.00
MR227399L4 Lenti ORF clone of Nkx2 (mGFP-tagged) - Mouse NK2 transcription factor related, locus 5 (Drosophila) (Nkx2-5) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.