Maf (NM_001025577) Mouse Untagged Clone

SKU
MC208926
Maf (untagged) - Mouse avian musculoaponeurotic fibrosarcoma (v-maf) AS42 oncogene homolog (Maf), (10ug)
$457.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Maf
Synonyms 2810401A20Rik; A230108G15Rik; AW047063; c-maf
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208926 representing NM_001025577
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTTCAGAACTGGCAATGAACAATTCCGACCTGCCCACCAGTCCCCTGGCCATGGAATATGTTAATG
ACTTCGATCTGATGAAGTTTGAAGTGAAAAAGGAACCGGTGGAGACCGACCGCATCATCAGCCAGTGCGG
CCGTCTCATCGCCGGGGGCTCGCTGTCCTCCACCCCCATGAGCACGCCCTGCAGCTCGGTGCCCCCGTCC
CCCAGCTTCTCGGCGCCCAGCCCGGGCTCGGGCAGCGAACAGAAGGCGCACCTGGAAGACTACTACTGGA
TGACCGGCTACCCGCAGCAGCTCAACCCGGAGGCGCTGGGCTTCAGCCCGGAGGACGCGGTCGAGGCGCT
CATCAGCAACAGCCACCAGCTCCAGGGTGGCTTCGATGGCTATGCGCGGGGAGCGCAGCAGCTGGCCGCG
GCAGCGGGGGCCGGCGCCGGCGCCTCCCTGGGCGGCAGCGGCGAGGAGATGGGCCCCGCCGCCGCCGTGG
TGTCCGCCGTGATCGCCGCGGCCGCCGCGCAGAGCGGCGCGGCACCCCACTACCATCACCACCACCACCA
CGCCGCGGGGCACCACCACCATCCGACGGCCGGCGCCCCGGGAGCCGCGGGCGGCGCGTCTGCCTCTGCG
AGCGGCGCGGGTGGCGCGGGCGGCGGTGGCCCGGCCAGCGCCGGGGGCGGCGGCGGCGGAGGCGGCGGCG
GGGGCACGGCGGGGGCGGGGGGCGCCCTGCACCCGCACCATGCCGCGGGCGGCCTGCACTTCGACGACCG
CTTCTCGGACGAGCAGTTGGTGACCATGTCGGTGCGCGAGCTGAACCGGCAGCTGCGCGGGGTCAGCAAG
GAGGAGGTGATCCGACTGAAGCAGAAGAGGCGGACCCTGAAAAACCGCGGCTATGCCCAGTCCTGCCGCT
TCAAGAGGGTGCAGCAGAGACACGTCCTGGAGTCGGAGAAGAACCAGCTGCTGCAGCAGGTAGACCACCT
CAAGCAGGAGATCTCCAGGCTGGTGCGCGAAAGGGACGCCTACAAGGAGAAATACGAGAAGCTGGTGAGC
AACGGCTTCCGAGAAAACGGCTCGAGCAGCGACAACCCTTCCTCTCCCGAATTTTTCATGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI
ACCN NM_001025577
Insert Size 1113 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001025577.2, NP_001020748.2
RefSeq Size 3642 bp
RefSeq ORF 1113 bp
Locus ID 17132
UniProt ID P54843
Cytogenetics 8 62.61 cM
Summary Acts as a transcriptional activator or repressor. When overexpressed, represses anti-oxidant response element (ARE)-mediated transcription. Involved either as an oncogene or as a tumor suppressor, depending on the cell context. Binds to the ARE sites of detoxifying enzyme gene promoters (By similarity). Involved in embryonic lens fiber cell development. Recruits the transcriptional coactivators CREBBP and/or EP300 to crystallin promoters leading to up-regulation of crystallin gene during lens fiber cell differentiation. Activates the expression of IL4 in T helper 2 (Th2) cells. Increases T-cell susceptibility to apoptosis by interacting with MYB and decreasing BCL2 expression. Together with PAX6, transactivates strongly the glucagon gene promoter through the G1 element. Activates transcription of the CD13 proximal promoter in endothelial cells. Represses transcription of the CD13 promoter in early stages of myelopoiesis by affecting the ETS1 and MYB cooperative interaction. Involved in the initial chondrocyte terminal differentiation and the disappearance of hypertrophic chondrocytes during endochondral bone development. Binds to the sequence 5'-[GT]G[GC]N[GT]NCTCAGNN-3' in the L7 promoter. Binds to the T-MARE (Maf response element) sites of lens-specific alpha- and beta-crystallin gene promoters. Binds element G1 on the glucagon promoter. Binds an AT-rich region adjacent to the TGC motif (atypical Maf response element) in the CD13 proximal promoter in endothelial cells. It may interact with additional basic-zipper proteins that determine a subtype of Maf-responsive element binding.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Maf (NM_001025577) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG227131 Maf (tGFP-tagged) - Mouse avian musculoaponeurotic fibrosarcoma (v-maf) AS42 oncogene homolog (Maf), (10ug) 10 ug
$886.00
MR227131 Maf (Myc-DDK-tagged) - Mouse avian musculoaponeurotic fibrosarcoma (v-maf) AS42 oncogene homolog (Maf) 10 ug
$686.00
MR227131L3 Lenti ORF clone of Maf (Myc-DDK-tagged) - Mouse avian musculoaponeurotic fibrosarcoma (v-maf) AS42 oncogene homolog (Maf) 10 ug
$986.00
MR227131L4 Lenti ORF clone of Maf (mGFP-tagged) - Mouse avian musculoaponeurotic fibrosarcoma (v-maf) AS42 oncogene homolog (Maf) 10 ug
$986.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.