Klrb1a (NM_010737) Mouse Untagged Clone

SKU
MC208910
Klrb1a (untagged) - Mouse killer cell lectin-like receptor subfamily B member 1A (Klrb1a), transcript variant 1, (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Klrb1a
Synonyms ly-55A; Ly55a; NKR-P1.7; NKR-P1A; Nkrp1-a; Nkrp1a; NKRP12
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208910 representing NM_010737
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCATCTCCTATGCACAATGGACACAGCAAGGGTCTACTTTGGTTTAAAGCCACCCAGGACTCCAGGGG
CTTGGCATGAGTCACCCCCATCTCTTCCCCCAGATGCCTGTCGGTGCCCACGTTCACACAGGTTGGCTCT
GAAGCTCAGCTGTGCTGGGCTCATCCTCCTTGTCGTGACCCTGATTGGGATGAGTGTTTTAGTGCGAGTC
CTAATACAAAAACCATCAATAGAAAAATGCTATGTGCTTATTCAAGAGAACCTGAATAAAACAACAGATT
GTTCAGCTAAGCTAGAGTGCCCACAAGACTGGCTTTCACACCGAGATAAGTGCTTTCACGTTTCTCAAGT
TTCCAACACTTGGGAGGAAGGTCTAGTTGATTGTGATGGAAAAGGAGCCACTTTGATGCTCATTCAAGAC
CAAGAAGAACTGAGATTCCTACTGGACTCAATAAAGGAAAAATACAATTCATTTTGGATTGGACTAAGGT
ACACATTGCCAGACATGAACTGGAAGTGGATAAATGGATCGACTTTAAATTCTGATGTATTAAAAATCAC
TGGTGACACTGAAAATGACAGCTGTGCTGCTATCTCAGGAGACAAAGTGACTTTTGAGAGCTGTAATTCA
GACAACCGTTGGATCTGCCAAAAGGAACTATACCATGAAACCCTGAGCAACTATGTGGGTTATGGACACT
GA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_010737
Insert Size 702 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_010737.3, NP_034867.3
RefSeq Size 1284 bp
RefSeq ORF 702 bp
Locus ID 17057
UniProt ID P27811
Cytogenetics 6 63.06 cM
Summary Plays a stimulatory role on natural killer (NK) cell cytotoxicity.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). CCDS Note: An upstream translation start codon is selected for this CCDS based on better conservation with mouse paralogs. The use of an alternative upstream start codon, which appears to be mouse-specific, would result in a protein that is 6 aa longer at the N-terminal.
Write Your Own Review
You're reviewing:Klrb1a (NM_010737) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG217102 Klrb1a (tGFP-tagged) - Mouse killer cell lectin-like receptor subfamily B member 1A (Klrb1a) transcript variant 1, (10ug) 10 ug
$500.00
MR217102 Klrb1a (Myc-DDK-tagged) - Mouse killer cell lectin-like receptor subfamily B member 1A (Klrb1a), transcript variant 1 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR217102L3 Lenti ORF clone of Klrb1a (Myc-DDK-tagged) - Mouse killer cell lectin-like receptor subfamily B member 1A (Klrb1a), transcript variant 1 10 ug
$600.00
MR217102L4 Lenti ORF clone of Klrb1a (mGFP-tagged) - Mouse killer cell lectin-like receptor subfamily B member 1A (Klrb1a), transcript variant 1 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.