Ldhb (NM_008492) Mouse Untagged Clone

SKU
MC208874
Ldhb (untagged) - Mouse lactate dehydrogenase B (Ldhb), (10ug)
  $686.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ldhb
Synonyms AI790582; H-Ld; H-Ldh; Ldh-; Ldh-2; LDH-B; LDH-H; Ldh2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208874 representing NM_008492
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAACCCTTAAGGAGAAGCTCATTGCGTCCGTTGCAGATGATGAGGCTGCCGTCCCGAACAACAAGA
TCACTGTAGTGGGCGTTGGACAAGTGGGTATGGCATGTGCCATCAGCATTCTGGGAAAGTCTCTGGCTGA
TGAACTTGCCCTGGTGGATGTGTTGGAAGACAAGCTCAAAGGAGAGATGATGGACCTGCAGCACGGGAGC
TTGTTCCTCCAGACTCCGAAAATTGTGGCCGATAAAGATTACTCTGTGACAGCCAACTCTAAGATTGTGG
TGGTGACGGCAGGAGTCCGCCAGCAGGAGGGGGAGAGTCGGCTCAACCTGGTGCAGAGAAATGTCAACGT
GTTCAAGTTCATCATTCCTCAGATCGTCAAGTACAGCCCTGACTGCACCATCATCGTGGTTTCCAACCCA
GTGGATATTCTGACTTACGTCACCTGGAAACTGAGCGGGCTACCTAAGCACCGTGTGATTGGAAGCGGAT
GCAATCTGGATTCTGCTCGATTCCGCTACCTCATGGCAGAGAAGCTTGGCATTCATCCCAGCAGCTGCCA
CGGATGGATCCTGGGCGAGCATGGAGACTCCAGTGTGGCTGTGTGGAGCGGGGTGAATGTGGCAGGAGTC
TCCCTCCAGGAACTGAATCCAGAAATGGGGACAGACAATGACAGTGAGAACTGGAAGGAGGTGCATAAGA
TGGTGGTGGACAGTGCCTATGAAGTCATCAAGCTCAAAGGCTACACCAACTGGGCCATCGGCCTGAGCGT
GGCTGACCTCATCGAGTCCATGCTGAAAAACCTCTCCCGGATTCACCCCGTGTCTACCATGGTGAAGGGA
ATGTACGGCATTGAGAATGAAGTCTTCCTCAGTCTCCCGTGCATCCTCAATGCTCGGGGGCTGACCAGCG
TCATCAATCAGAAGCTGAAGGACGATGAGGTCGCTCAGCTCAGGAAGAGTGCGGACACCCTGTGGGACAT
CCAGAAAGACCTCAAAGACCTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI |
ACCN NM_008492
Insert Size 1005 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC046755, AAH46755
RefSeq Size 1324 bp
RefSeq ORF 1005 bp
Locus ID 16832
UniProt ID P16125
Cytogenetics 6 74.17 cM
Summary This gene encodes the B subunit of lactate dehydrogenase enzyme, which catalyzes the interconversion of pyruvate and lactate with concomitant interconversion of NADH and NAD+ in a post-glycolysis process. Alternatively spliced transcript variants have also been found for this gene. Recent studies have shown that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. Pseudogenes have been identified on chromosomes 1 and 19. provided by RefSeq, Feb 2016
Transcript Variant: This variant (1) encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (Ldhb) results from translation termination at the upstream UGA stop codon, while the longer isoform (Ldhbx) results from UGA stop codon readthrough to the downstream UAG termination codon. This RefSeq represents the shorter isoform (Ldhb), which is localized in the cytosol.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_008492" in other vectors (4)
SKU Description Size Price
MG204957 Ldhb (tGFP-tagged) - Mouse lactate dehydrogenase B (Ldhb) 10 ug
$489.00 $657.00
MR204957 Ldhb (Myc-DDK-tagged) - Mouse lactate dehydrogenase B (Ldhb) 10 ug
$289.00 $457.00
MR204957L3 Lenti ORF clone of Ldhb (Myc-DDK-tagged) - Mouse lactate dehydrogenase B (Ldhb) 10 ug
$757.00
MR204957L4 Lenti ORF clone of Ldhb (mGFP-tagged) - Mouse lactate dehydrogenase B (Ldhb) 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products