Lamp2 (NM_001017959) Mouse Untagged Clone

SKU
MC208863
Lamp2 (untagged) - Mouse lysosomal-associated membrane protein 2 (Lamp2), transcript variant 1, (10ug)
$686.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Lamp2
Synonyms CD107b; Lamp-2; Lamp-2a; Lamp-2b; Lamp-2c; Lamp II; LGP-B; Mac3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208863 representing NM_001017959
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTGCCTCTCTCCGGTTAAAGGCGCAAAGCTCATCCTGATCTTTCTGTTCCTAGGAGCCGTTCAGTCCA
ATGCATTGATAGTTAATTTGACAGATTCAAAGGGTACTTGCCTTTATGCAGAATGGGAGATGAATTTCAC
AATAACATATGAAACTACAAACCAAACCAATAAAACTATAACCATTGCAGTACCTGACAAGGCGACACAC
GATGGAAGCAGTTGTGGGGATGACCGGAATAGTGCCAAAATAATGATACAATTTGGATTCGCTGTCTCTT
GGGCTGTGAATTTTACCAAGGAAGCATCTCATTATTCAATTCATGACATCGTGCTTTCCTACAACACTAG
TGATAGCACAGTATTTCCTGGTGCTGTAGCTAAAGGAGTTCATACTGTTAAAAATCCTGAGAATTTCAAA
GTTCCATTGGATGTCATCTTTAAGTGCAATAGTGTTTTAACTTACAACCTGACTCCTGTCGTTCAGAAAT
ATTGGGGTATTCACCTGCAAGCTTTTGTCCAAAATGGTACAGTGAGTAAAAATGAACAAGTGTGTGAAGA
AGACCAAACTCCCACCACTGTGGCACCCATCATTCACACCACTGCCCCGTCGACTACAACTACACTCACT
CCAACTTCAACACCCACTCCAACTCCAACTCCAACTCCAACCGTTGGAAACTACAGCATTAGAAATGGCA
ATACTACCTGTCTGCTGGCTACCATGGGGCTGCAGCTGAACATCACTGAGGAGAAGGTGCCTTTCATTTT
TAACATCAACCCTGCCACAACCAACTTCACCGGCAGCTGTCAACCTCAAAGTGCTCAACTTAGGCTGAAC
AACAGCCAAATTAAGTATCTTGACTTTATCTTTGCTGTGAAAAATGAAAAACGGTTCTATCTGAAGGAAG
TGAATGTCTACATGTATTTGGCTAATGGCTCAGCTTTCAACATTTCCAACAAGAACCTTAGCTTCTGGGA
TGCCCCTCTGGGAAGTTCTTATATGTGCAACAAAGAGCAGGTGCTTTCTGTGTCTAGAGCGTTTCAGATC
AACACCTTTAACCTAAAGGTGCAACCTTTTAATGTGACAAAAGGACAGTATTCTACAGCTCAAGACTGCA
GTGCAGATGAAGACAACTTCCTTGTGCCCATAGCGGTGGGAGCAGCTCTGGGAGGAGTACTTATTCTAGT
GTTGCTGGCTTATTTTATTGGTCTCAAGCGCCATCATACTGGATATGAGCAATTTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI
ACCN NM_001017959
Insert Size 1248 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001017959.1, NP_001017959.1
RefSeq Size 1768 bp
RefSeq ORF 1248 bp
Locus ID 16784
UniProt ID P17047
Cytogenetics X 22.67 cM
Summary Plays an important role in chaperone-mediated autophagy, a process that mediates lysosomal degradation of proteins in response to various stresses and as part of the normal turnover of proteins with a long biological half-live (PubMed:10972293). Functions by binding target proteins, such as GAPDH and MLLT11, and targeting them for lysosomal degradation (By similarity). Required for the fusion of autophagosomes with lysosomes during autophagy (PubMed:27628032). Cells that lack LAMP2 express normal levels of VAMP8, but fail to accumulate STX17 on autophagosomes, which is the most likely explanation for the lack of fusion between autophagosomes and lysosomes (PubMed:27628032). Required for normal degradation of the contents of autophagosomes (PubMed:10972293, PubMed:12221139). Plays a role in lysosomal protein degradation in response to starvation (PubMed:27628032). Required for efficient MHCII-mediated presentation of exogenous antigens via its function in lysosomal protein degradation; antigenic peptides generated by proteases in the endosomal/lysosomal compartment are captured by nascent MHCII subunits. Is not required for efficient MHCII-mediated presentation of endogenous antigens (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) utilizes an alternate 3'-terminal exon, compared to variant 2. Isoform 1 has a unique C-terminus compared to isoform 2. COMPLETENESS: complete on the 3' end.
Write Your Own Review
You're reviewing:Lamp2 (NM_001017959) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG222878 Lamp2 (tGFP-tagged) - Mouse lysosomal-associated membrane protein 2 (Lamp2) transcript variant 1, (10ug) 10 ug
$886.00
MR222878 Lamp2 (Myc-DDK-tagged) - Mouse lysosomal-associated membrane protein 2 (Lamp2), transcript variant 1 10 ug
$686.00
MR222878L1 Lenti ORF clone of Lamp2 (Myc-DDK-tagged) - Mouse lysosomal-associated membrane protein 2 (Lamp2), transcript variant 1 10 ug
$986.00
MR222878L2 Lenti ORF clone of Lamp2 (mGFP-tagged) - Mouse lysosomal-associated membrane protein 2 (Lamp2), transcript variant 1 10 ug
$986.00
MR222878L3 Lenti ORF clone of Lamp2 (Myc-DDK-tagged) - Mouse lysosomal-associated membrane protein 2 (Lamp2), transcript variant 1 10 ug
$986.00
MR222878L4 Lenti ORF clone of Lamp2 (mGFP-tagged) - Mouse lysosomal-associated membrane protein 2 (Lamp2), transcript variant 1 10 ug
$986.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.