Il12a (NM_001159424) Mouse Untagged Clone

SKU
MC208769
Il12a (untagged) - Mouse interleukin 12a (Il12a), transcript variant 1, (10ug)
$300.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Il12a
Synonyms Il-12a; IL-12p35; Ll12a; p35
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NM_001159424.1
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTCAGCGTTCCAACAGCCTCACCCTCGGCATCCAGCAGCTCCTCTCAGTGCCGGTCCAGCATGTGTC
AATCACGCTACCTCCTCTTTTTGGCCACCCTTGCCCTCCTAAACCACCTCAGTTTGGCCAGGGTCATTCC
AGTCTCTGGACCTGCCAGGTGTCTTAGCCAGTCCCGAAACCTGCTGAAGACCACAGATGACATGGTGAAG
ACGGCCAGAGAAAAACTGAAACATTATTCCTGCACTGCTGAAGACATCGATCATGAAGACATCACACGGG
ACCAAACCAGCACATTGAAGACCTGTTTACCACTGGAACTACACAAGAACGAGAGTTGCCTGGCTACTAG
AGAGACTTCTTCCACAACAAGAGGGAGCTGCCTGCCCCCACAGAAGACGTCTTTGATGATGACCCTGTGC
CTTGGTAGCATCTATGAGGACTTGAAGATGTACCAGACAGAGTTCCAGGCCATCAACGCAGCACTTCAGA
ATCACAACCATCAGCAGATCATTCTAGACAAGGGCATGCTGGTGGCCATCGATGAGCTGATGCAGTCTCT
GAATCATAATGGCGAGACTCTGCGCCAGAAACCTCCTGTGGGAGAAGCAGACCCTTACAGAGTGAAAATG
AAGCTCTGCATCCTGCTTCACGCCTTCAGCACCCGCGTCGTGACCATCAACAGGGTGATGGGCTATCTGA
GCTCCGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI
ACCN NM_001159424
Insert Size 711 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001159424.1, NP_001152896.1
RefSeq Size 1303 bp
RefSeq ORF 711 bp
Locus ID 16159
UniProt ID P43431
Cytogenetics 3 31.92 cM
Summary Cytokine that can act as a growth factor for activated T and NK cells, enhance the lytic activity of NK/lymphokine-activated killer cells, and stimulate the production of IFN-gamma by resting PBMC.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:Il12a (NM_001159424) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG225609 Il12a (tGFP-tagged) - Mouse interleukin 12a (Il12a) transcript variant 1, (10ug) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
MR225609 Il12a (Myc-DDK-tagged) - Mouse interleukin 12a (Il12a), transcript variant 1 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR225609L3 Lenti ORF clone of Il12a (Myc-DDK-tagged) - Mouse interleukin 12a (Il12a), transcript variant 1 10 ug
$600.00
MR225609L4 Lenti ORF clone of Il12a (mGFP-tagged) - Mouse interleukin 12a (Il12a), transcript variant 1 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.