H2-Ke6 (NM_013543) Mouse Untagged Clone

SKU
MC208627
H2 (untagged) - Mouse H2-K region expressed gene 6 (H2-Ke6), (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol H2-Ke6
Synonyms D17H6S112E; H-2Ke6; Hsd17b8; Ke-6; Ke6; Ring2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208627 representing NM_013543
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGTCTCAGCTCCGGCTCCGCTCTGCGCTGGCCCTGGTCACAGGTGCGGGTAGCGGCATCGGCCGTG
CGATCAGCGTGCGCCTAGCGGCAGAGGGCGCCGCCGTGGCCGCCTGCGACCTGGACGGGGCCGCGGCACA
GGACACGGTGCGGCTGCTGGGAAGCCCGGGGAGCGAGGACGGGGCGCCGCGCGGCAAGCACGCTGCCTTC
CAAGCGGATGTGTCTCAGGGCCCCGCAGCCAGACGCCTGCTGGAGGAAGTGCAGGCCTGCTTTTCTCGCC
CGCCATCTGTCGTTGTGTCCTGTGCGGGCATCACACGCGATGAGTTTCTGCTCCACATGTCAGAAGAAGA
CTGGGACAGAGTCATAGCTGTCAACCTCAAGGGCACCTTCCTAGTCACTCAGGCTGCAGCCCAGGCTTTA
GTGTCCAGTGGCGGTCGTGGCTCCATCATCAACATTAGTAGCATCATTGGAAAGGTGGGGAATATCGGAC
AAACGAATTATGCGTCGTCCAAAGCAGGAGTGATTGGGCTCACCCAGACTGCGGCCCGGGAGCTTGGACG
ACATGGAATCCGATGTAACTCGGTCCTCCCAGGGTTCATTGCAACGCCCATGACCCAGAAAATGCCAGAG
AAAGTGAAGGACAAGGTAACTGCAATGATTCCGTTGGGACACATGGGGGACCCTGAGGATGTGGCAGATG
TGGTTGCATTCTTGGCATCTGAAGACAGTGGATACATCACAGGGGCCTCCGTGGAAGTCAGTGGAGGTCT
TTTCATGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_013543
Insert Size 780 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_013543.2, NP_038571.2
RefSeq Size 981 bp
RefSeq ORF 780 bp
Locus ID 14979
UniProt ID P50171
Cytogenetics 17 17.98 cM
Summary NAD-dependent 17-beta-hydroxysteroid dehydrogenase with highest activity towards estradiol. Has very low activity towards testosterone (PubMed:9712896). The heterotetramer with CBR4 has NADH-dependent 3-ketoacyl-acyl carrier protein reductase activity, and thereby plays a role in mitochondrial fatty acid biosynthesis. Within the heterotetramer, HSD17B8 binds NADH; CBR4 binds NADPD.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:H2-Ke6 (NM_013543) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG218574 H2 (tGFP-tagged) - Mouse H2-K region expressed gene 6 (H2-Ke6), (10ug) 10 ug
$650.00
MR218574 H2 (Myc-DDK-tagged) - Mouse H2-K region expressed gene 6 (H2-Ke6) 10 ug
$450.00
MR218574L3 Lenti ORF clone of H2 (Myc-DDK-tagged) - Mouse H2-K region expressed gene 6 (H2-Ke6) 10 ug
$750.00
MR218574L4 Lenti ORF clone of H2 (mGFP-tagged) - Mouse H2-K region expressed gene 6 (H2-Ke6) 10 ug
$750.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.