Fst (NM_008046) Mouse Untagged Clone

SKU
MC208510
Fst (untagged) - Mouse follistatin (Fst), (10ug)
$457.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Fst
Synonyms AL033346; D2Mgi5; FS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208510 representing NM_008046
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTCTGCGCCAGGCACCAGCCCGGCGGGCTCTGCCTCCTGCTGCTGCTACTCTGCCAGTTCATGGAGG
ACCGCAGCGCCCAGGCTGGGAATTGCTGGCTCCGCCAAGCAAAGAACGGCCGCTGCCAGGTCCTGTATAA
GACAGAACTGAGCAAGGAAGAGTGTTGCAGCACCGGCCGGCTGAGCACCTCATGGACCGAGGAGGATGTG
AACGACAATACTCTCTTCAAGTGGATGATTTTCAACGGGGGCGCCCCCAACTGCATCCCTTGTAAAGAAA
CGTGTGAGAACGTGGACTGCGGACCTGGGAAAAAATGTCGAATGAACAAGAAGAATAAACCCCGCTGCGT
CTGTGCCCCAGACTGTTCCAACATCACCTGGAAGGGCCCAGTGTGTGGGCTGGATGGGAAAACCTACCGC
AACGAATGTGCACTCCTCAAGGCCAGATGCAAAGAGCAGCCGGAACTAGAAGTACAGTACCAGGGCAAAT
GTAAAAAGACTTGTAGGGATGTTTTTTGTCCAGGCAGCTCCACTTGTGTGGTGGATCAGACCAATAATGC
CTACTGTGTGACCTGTAATCGGATTTGCCCAGAGCCCTCCTCTTCTGAACAGTACCTTTGTGGAAATGAT
GGAGTGACTTACTCCAGCGCCTGCCACCTGAGAAAGGCCACCTGCTTGCTGGGCAGATCCATTGGATTAG
CCTATGAGGGAAAGTGTATCAAAGCAAAGTCCTGTGAAGATATCCAGTGTGGCGGCGGGAAAAAATGCCT
ATGGGATTCCAAGGTTGGCAGAGGTCGCTGCTCTCTCTGCGATGAGCTGTGTCCTGACAGTAAGTCGGAT
GAGCCGGTCTGTGCCAGTGACAATGCCACATACGCCAGCGAGTGTGCCATGAAGGAAGCTGCCTGCTCTT
CTGGCGTGCTTCTTGAAGTGAAGCATTCTGGATCTTGCAACTCCATCTCGGAAGAAACGGAGGAAGAGGA
GGAGGAGGAAGACCAGGACTACAGCTTTCCTATCTCTTCCATTCTAGAGTGGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_008046
Insert Size 1035 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC145945, AAI45946
RefSeq Size 1272 bp
RefSeq ORF 1032 bp
Locus ID 14313
UniProt ID P47931
Cytogenetics 13 D2.2
Summary The protein encoded by this gene binds to and negatively regulates activin, as well as other members of the transforming growth factor beta family, and acts to prevent uncontrolled cellular proliferation. This protein also contains a heparin-binding sequence. It is expressed in many of the tissues in which activin is synthesized and is thought to clear activin from the circulation by attachment to the cell surface. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms, including FST315 and FST288, that differ at their C-terminus. Another isoform, FST303 is thought to be produced by proteolytic cleavage of FST315. These isoforms differ in their localization and in their ability to bind heparin. While FST315 is a circulating protein, FST288 is tissue-bound, and FST303 is gonad-specific. While deletion of all isoforms results in embryonic lethality, expression of just FST288 is sufficient for embryonic development, but the resultant mice have fertility defects. [provided by RefSeq, Aug 2014]
Transcript Variant: This variant (2) uses an alternate in-frame splice site compared to variant 1. It encodes isoform 2 which is shorter than isoform 1.
Write Your Own Review
You're reviewing:Fst (NM_008046) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG225488 Fst (tGFP-tagged) - Mouse follistatin (Fst), (10ug) 10 ug
$657.00
MR225488 Fst (Myc-DDK-tagged) - Mouse follistatin (Fst) 10 ug
$289.00 MSRP $457.00 MSRP $457.00
MR225488L3 Lenti ORF clone of Fst (Myc-DDK-tagged) - Mouse follistatin (Fst) 10 ug
$757.00
MR225488L4 Lenti ORF clone of Fst (mGFP-tagged) - Mouse follistatin (Fst) 10 ug
$757.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.