Flt3l (NM_013520) Mouse Untagged Clone

SKU
MC208499
Flt3l (untagged) - Mouse FMS-like tyrosine kinase 3 ligand (Flt3l), (10ug)
$450.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Flt3l
Synonyms Flt3lg; Ly72L
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NM_013520.3
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACAGTGCTGGCGCCAGCCTGGAGCCCAAATTCCTCCCTGTTGCTGCTGTTGCTGCTGCTGAGTCCTT
GCCTGCGGGGGACACCTGACTGTTACTTCAGCCACAGTCCCATCTCCTCCAACTTCAAAGTGAAGTTTAG
AGAGTTGACTGACCACCTGCTTAAAGATTACCCAGTCACTGTGGCCGTCAATCTTCAGGACGAGAAGCAC
TGCAAGGCCTTGTGGAGCCTCTTCCTAGCCCAGCGCTGGATAGAGCAACTGAAGACTGTGGCAGGGTCTA
AGATGCAAACGCTTCTGGAGGACGTCAACACCGAGATACATTTTGTCACCTCATGTACCTTCCAGCCCCT
ACCAGAATGTCTGCGATTCGTCCAGACCAACATCTCCCACCTCCTGAAGGACACCTGCACACAGCTGCTT
GCTCTGAAGCCCTGTATCGGGAAGGCCTGCCAGAATTTCTCTCGGTGCCTGGAGGTGCAGTGCCAGCCGG
ACTCCTCCACCCTGCTGCCCCCAAGGAGTCCCATAGCCCTAGAAGCCACGGAGCTCCCAGAGCCTCGGCC
CAGGCAGCTGTTGCTCCTGCTGCTGCTGCTGCTGCCTCTCACACTGGTGCTGCTGGCAGCCGCCTGGGGC
CTTCGCTGGCAAAGGGCAAGAAGGAGGGGGGAGCTCCACCCTGGGGTGCCCCTCCCCTCCCATCCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI
ACCN NM_013520
Insert Size 699 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_013520.3, NP_038548.3
RefSeq Size 1075 bp
RefSeq ORF 699 bp
Locus ID 14256
UniProt ID P49772
Cytogenetics 7 29.14 cM
Summary Stimulates the proliferation of early hematopoietic cells by activating FLT3. Synergizes well with a number of other colony stimulating factors and interleukins.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and is the protein-coding variant.
Write Your Own Review
You're reviewing:Flt3l (NM_013520) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG227308 Flt3l (tGFP-tagged) - Mouse FMS-like tyrosine kinase 3 ligand (Flt3l), (10ug) 10 ug
$489.00 MSRP $650.00 MSRP $650.00
MR227308 Flt3l (Myc-DDK-tagged) - Mouse FMS-like tyrosine kinase 3 ligand (Flt3l) 10 ug
$289.00 MSRP $450.00 MSRP $450.00
MR227308L1 Lenti ORF clone of Flt3l (Myc-DDK-tagged) - Mouse FMS-like tyrosine kinase 3 ligand (Flt3l) 10 ug
$750.00
MR227308L2 Lenti ORF clone of Flt3l (mGFP-tagged) - Mouse FMS-like tyrosine kinase 3 ligand (Flt3l) 10 ug
$750.00
MR227308L3 Lenti ORF clone of Flt3l (Myc-DDK-tagged) - Mouse FMS-like tyrosine kinase 3 ligand (Flt3l) 10 ug
$750.00
MR227308L4 Lenti ORF clone of Flt3l (mGFP-tagged) - Mouse FMS-like tyrosine kinase 3 ligand (Flt3l) 10 ug
$750.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.