Nr2f6 (NM_010150) Mouse Untagged Clone

SKU
MC208448
Nr2f6 (untagged) - Mouse nuclear receptor subfamily 2, group F, member 6 (Nr2f6), (10ug)
$457.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Nr2f6
Synonyms AV090102; COUP-TF3; EAR2; Erbal2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208448 representing NM_010150
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCATGGTGACCGGTGGCTGGGGCGACCCCGGAGGCGACACGAACGGCGTGGACAAGGCTGGTGGGA
GCTACCCACGCGCGACCGAGGACGATTCGGCGTCACCTCCCGGGGCGACCAGCGACGCGGAGCCGGGCGA
CGAGGAGCGTCCGGGGTTGCAGGTGGACTGCGTGGTGTGCGGGGACAAGTCCAGTGGAAAGCATTACGGC
GTGTTCACCTGCGAGGGCTGCAAGAGTTTCTTCAAGCGCAGCATCCGCCGCAATCTCAGCTACACCTGCC
GGTCCAACCGTGACTGTCAGATTGATCAGCACCACCGGAACCAGTGTCAGTACTGTCGGCTCAAGAAGTG
CTTCCGGGTGGGCATGCGCAAGGAGGCCGTGCAGCGAGGCCGCATCCCGCATGCGCTCCCCGGTCCAGCG
GCCTGCAGTCCCCCGGGCGCGACGGGCGTCGAACCTTTCACGGGGCCGCCAGTGTCCGAGCTGATTGCGC
AGCTGCTGCGTGCTGAGCCCTACCCCGCGGCCGGACGCTTTGGTGGCGGCGGCGCTGTACTGGGCATCGA
CAACGTGTGCGAGTTGGCGGCACGCCTGCTGTTCAGCACGGTCGAGTGGGCCCGCCACGCGCCCTTCTTC
CCCGAGCTGCCGGCCGCCGACCAGGTGGCGCTGCTGCGGCTCAGCTGGAGTGAGCTCTTCGTGCTGAACG
CGGCGCAGGCGGCGCTGCCGCTGCATACGGCACCGCTGCTGGCCGCCGCGGGGTTGCATGCCGCGCCCAT
GGCAGCCGAGCGGGCCGTGGCCTTCATGGACCAGGTGCGTGCCTTCCAGGAGCAGGTGGACAAGCTGGGC
CGCCTGCAGGTGGATGCTGCGGAGTACGGCTGCCTCAAGGCCATCGCGCTCTTCACGCCTGATGCCTGTG
GCCTTTCTGACCCAGCCCATGTGGAGAGCCTGCAGGAGAAGGCACAGGTGGCCCTCACCGAGTATGTGCG
TGCCCAGTACCCATCGCAGCCCCAGCGCTTTGGGCGTCTGCTGCTGCGGCTGCCAGCCCTGCGTGCTGTG
CCCGCATCCCTCATCTCCCAGCTCTTCTTCATGCGCCTGGTGGGCAAGACACCCATCGAGACCCTCATCC
GGGACATGCTTCTGTCAGGGAGCACCTTTAACTGGCCCTATGGCTCGGGCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_010150
Insert Size 1173 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC008138, AAH08138
RefSeq Size 1959 bp
RefSeq ORF 1173 bp
Locus ID 13864
UniProt ID P43136
Cytogenetics 8 34.43 cM
Summary Transcription factor predominantly involved in transcriptional repression. Binds to promoter/enhancer response elements that contain the imperfect 5'-AGGTCA-3' direct or inverted repeats with various spacings which are also recognized by other nuclear hormone receptors. Involved in modulation of hormonal responses. Represses transcriptional activity of the lutropin-choriogonadotropic hormone receptor/LHCGR gene, the renin/REN gene and the oxytocin-neurophysin/OXT gene. Represses the triiodothyronine-dependent and -independent transcriptional activity of the thyroid hormone receptor gene in a cell type-specific manner. The corepressing function towards thyroid hormone receptor beta/THRB involves at least in part the inhibition of THRB binding to triiodothyronine response elements (TREs) by NR2F6. Inhibits NFATC transcription factor DNA binding and subsequently its transcriptional activity. Acts as transcriptional repressor of IL-17 expression in Th-17 differentiated CD4(+) T cells and may be involved in induction and/or maintenance of peripheral immunological tolerance and autoimmunity. Involved in development of forebrain circadian clock; is required early in the development of the locus coeruleus (LC).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Nr2f6 (NM_010150) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MR206083 Nr2f6 (Myc-DDK-tagged) - Mouse nuclear receptor subfamily 2, group F, member 6 (Nr2f6) 10 ug
$289.00 MSRP $457.00 MSRP $457.00
MR206083L3 Lenti ORF clone of Nr2f6 (Myc-DDK-tagged) - Mouse nuclear receptor subfamily 2, group F, member 6 (Nr2f6) 10 ug
$757.00
MR206083L4 Lenti ORF clone of Nr2f6 (mGFP-tagged) - Mouse nuclear receptor subfamily 2, group F, member 6 (Nr2f6) 10 ug
$757.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.