Dlx5 (NM_198854) Mouse Untagged Clone

SKU MC208397

Dlx5 (untagged) - Mouse distal-less homeobox 5 (Dlx5), transcript variant 2, (10ug)

Product Data

• Type: Mouse Untagged Clone
• Target Symbol: Dlx5
• Synonyms: AI385752
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208397 representing NM_198854; Red=Cloning site Blue=ORF Orange=Stop codon; ; TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC; GCCGCGATCGCC; ; ATGACAGGAGTGTTTGACAGAAGAGTCCCAAGCATCCGATCCGGCGACTTCCAAGCTCCGTTCCCGACGT; CCGCCGCCATGCACCACCCGTCTCAGGAATCGCCAACTTTGCCCGAGTCCTCGGCCACCGATTCTGACTA; CTACAGTCCCGCGGGGGCCGCCCCGCACGGCTACTGCTCTCCTACCTCTGCTTCTTATGGCAAAGCGCTC; AACCCCTACCAGTACCAGTACCACGGCGTGAACGGCTCCGCAGCCGGCTACCCGGCCAAGGCTTATGCCG; ACTACGGCTACGCCAGCCCCTACCACCAGTACGGCGGCGCCTACAACCGCGTCCCGAGTGCCACCAGCCA; GCCAGCTTTCAGCTGGCCGCTTTACAGAGAAGGTTTCAGAAGACTCAGTACCTCGCCCTGCCAGAACGCG; CGGAGTTGGCCGCCTCTCTAG; ; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT; ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_198854
• Insert Size: 441 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_198854.2, NP_942151.1
• RefSeq Size: 1328 bp
• RefSeq ORF: 441 bp
• Locus ID: 13395
• UniProt ID: P70396
• Cytogenetics: 6 2.83 cM
• Summary: Transcriptional factor involved in bone development. Acts as an immediate early BMP-responsive transcriptional activator essential for osteoblast differentiation. Stimulates ALPL promoter activity in a RUNX2-independent manner during osteoblast differentiation. Stimulates SP7 promoter activity during osteoblast differentiation. Promotes cell proliferation by up-regulating MYC promoter activity. Involved as a positive regulator of both chondrogenesis and chondrocyte hypertrophy in the endochondral skeleton. Binds to the homeodomain-response element of the ALPL and SP7 promoter. Binds to the MYC promoter. Requires the 5'-TAATTA-3' consensus sequence for DNA-binding.[UniProtKB/Swiss-Prot Function]; Transcript Variant: This variant (2) uses an alternate splice site in the central coding region, resulting in a frameshift and an early stop codon, compared to variant 1. It encodes isoform 2, which is shorter and has a distinct C-terminus, compared to isoform 1.