Csf2 (NM_009969) Mouse Untagged Clone

SKU
MC208342
Csf2 (untagged) - Mouse colony stimulating factor 2 (granulocyte-macrophage) (Csf2), (10ug)
$225.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Csf2
Synonyms CSF; Csfgm; Gm-CSf; GMCSF; MGI-IGM
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208342 representing NM_009969
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTGGCTGCAGAATTTACTTTTCCTGGGCATTGTGGTCTACAGCCTCTCAGCACCCACCCGCTCACCCA
TCACTGTCACCCGGCCTTGGAAGCATGTAGAGGCCATCAAAGAAGCCCTGAACCTCCTGGATGACATGCC
TGTCACATTGAATGAAGAGGTAGAAGTCGTCTCTAACGAGTTCTCCTTCAAGAAGCTAACATGTGTGCAG
ACCCGCCTGAAGATATTCGAGCAGGGTCTACGGGGCAATTTCACCAAACTCAAGGGCGCCTTGAACATGA
CAGCCAGCTACTACCAGACATACTGCCCCCCAACTCCGGAAACGGACTGTGAAACACAAGTTACCACCTA
TGCGGATTTCATAGACAGCCTTAAAACCTTTCTGACTGATATCCCCTTTGAATGCAAAAAACCAGTCCAA
AAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_009969
Insert Size 426 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC116880, AAI16881
RefSeq Size 618 bp
RefSeq ORF 426 bp
Locus ID 12981
UniProt ID P01587
Cytogenetics 11 32.13 cM
Summary Cytokine that stimulates the growth and differentiation of hematopoietic precursor cells from various lineages, including granulocytes, macrophages, eosinophils and erythrocytes.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Csf2 (NM_009969) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG222594 Csf2 (tGFP-tagged) - Mouse colony stimulating factor 2 (granulocyte-macrophage) (Csf2), (10ug) 10 ug
$489.00
MR222594 Csf2 (Myc-DDK-tagged) - Mouse colony stimulating factor 2 (granulocyte-macrophage) (Csf2) 10 ug
$289.00
MR222594L1 Lenti ORF clone of Csf2 (Myc-DDK-tagged) - Mouse colony stimulating factor 2 (granulocyte-macrophage) (Csf2) 10 ug
$525.00
MR222594L2 Lenti ORF clone of Csf2 (mGFP-tagged) - Mouse colony stimulating factor 2 (granulocyte-macrophage) (Csf2) 10 ug
$525.00
MR222594L3 Lenti ORF clone of Csf2 (Myc-DDK-tagged) - Mouse colony stimulating factor 2 (granulocyte-macrophage) (Csf2) 10 ug
$525.00
MR222594L4 Lenti ORF clone of Csf2 (mGFP-tagged) - Mouse colony stimulating factor 2 (granulocyte-macrophage) (Csf2) 10 ug
$525.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.