Cd33 (NM_021293) Mouse Untagged Clone
Product Data | |
Type | Mouse Untagged Clone |
---|---|
Target Symbol | Cd33 |
Synonyms | gp67; Siglec-3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>MC208243 representing NM_021293
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGTGGCCACTGCCGCTGTTCTTGCTGTGTGCAGGCTCCCTGGCTCAGGATTTAGAATTCCAGCTGG TGGCGCCCGAGTCAGTGACAGTCGAGGAGGGCCTATGTGTCCATGTGCCCTGCAGTGTTTTCTACCCCTC CATTAAGCTCACTTTAGGACCTGTGACCGGCTCCTGGCTCCGGAAAGGGGTCAGTCTCCATGAAGACTCT CCAGTGGCCACAAGTGACCCCAGACAACTAGTGCAGAAGGCAACACAGGGCAGATTCCAACTCCTTGGGG ACCCACAGAAACATGACTGTTCCCTGTTCATCAGAGATGCACAGAAAAATGACACAGGAATGTACTTCTT CAGAGTGGTCAGAGAACCTTTTGTGAGATATTCTTACAAAAAAAGCCAGCTGTCACTGCATGTGACCTCT CTATCACGGACTCCTGACATTATAATCCCGGGGACCCTGGAGGCTGGCTATCCTAGCAATCTCACCTGCT CTGTGCCCTGGGCTTGTGAGCAGGGGACACCCCCTACTTTCTCCTGGATGTCAACTGCCCTCACCTCCTT GAGTTCCCGAACCACAGACTCCTCCGTGCTGACGTTCACACCTCAGCCTCAGGACCATGGTACCAAACTC ACCTGCTTGGTGACCTTCTCTGGAGCAGGTGTCACTGTGGAAAGGACCATCCAGCTCAATGTTACCCGGA AATCAGGCCAGATGAGAGAGCTGGTCCTGGTGGCTGTGGGGGAGGCAACGGTCAAGCTCCTGATTCTTGG GCTCTGTCTCGTGTTTCTCATTGTGATGTTCTGCAGAAGGAAGACAACAAAGCTGTCAGTGCACATGGGC TGTGAAAATCCTATCAAGGCTCATCAGCAGGACTCCAAGGTGCACAGCAATCCTGAGAATCCAAGACCCT TACAGAAGGACTCACCTCAGGAACAGAGCAGTGTCCACACTAAGATTTCCTTGGATTTCATGGGAGGGAA GCCTCAGGAGTACTCAGAGATCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_021293 |
Insert Size | 1005 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_021293.3, NP_067268.1 |
RefSeq Size | 2488 bp |
RefSeq ORF | 1005 bp |
Locus ID | 12489 |
UniProt ID | Q63994 |
Cytogenetics | 7 28.25 cM |
Summary | Sialic-acid-binding immunoglobulin-like lectin (Siglec) that plays a role in mediating cell-cell interactions and in maintaining immune cells in a resting state (By similarity). Preferentially binds sialic acid to the short O-linked glycans of certain mucins (PubMed:12773563).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an exon in the 3' coding region that results in a frameshift compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct C-terminus compared to isoform 1. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
MG219960 | Cd33 (tGFP-tagged) - Mouse CD33 antigen (Cd33) transcript variant 2, (10ug) | 10 ug |
$886.00
|
|
MR219960 | Cd33 (Myc-DDK-tagged) - Mouse CD33 antigen (Cd33), transcript variant 2 | 10 ug |
$686.00
|
|
MR219960L1 | Lenti ORF clone of Cd33 (Myc-DDK-tagged) - Mouse CD33 antigen (Cd33), transcript variant 2 | 10 ug |
$986.00
|
|
MR219960L2 | Lenti ORF clone of Cd33 (mGFP-tagged) - Mouse CD33 antigen (Cd33), transcript variant 2 | 10 ug |
$986.00
|
|
MR219960L3 | Lenti ORF clone of Cd33 (Myc-DDK-tagged) - Mouse CD33 antigen (Cd33), transcript variant 2 | 10 ug |
$986.00
|
|
MR219960L4 | Lenti ORF clone of Cd33 (mGFP-tagged) - Mouse CD33 antigen (Cd33), transcript variant 2 | 10 ug |
$986.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.