Apoe (NM_009696) Mouse Untagged Clone

SKU
MC208139
Apoe (untagged) - Mouse apolipoprotein E (Apoe), (10ug)
$300.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Apoe
Synonyms A; AI255918; Apo-E
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208139 representing NM_009696
Red=Cloning site Blue=ORF

CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCGGCGC
GCC
C

ATGAAGGCTCTGTGGGCCGTGCTGTTGGTCACATTGCTGACAGGATGCCTAGCCGAGGGAGAGCCGGAGG
TGACAGATCAGCTCGAGTGGCAAAGCAACCAACCCTGGGAGCAGGCCCTGAACCGCTTCTGGGATTACCT
GCGCTGGGTGCAGACGCTGTCTGACCAGGTCCAGGAAGAGCTGCAGAGCTCCCAAGTCACACAAGAACTG
ACGGCACTGATGGAGGACACTATGACGGAAGTAAAGGCTTACAAAAAGGAGCTGGAGGAACAGCTGGGTC
CAGTGGCGGAGGAGACACGGGCCAGGCTGGGCAAAGAGGTGCAGGCGGCACAGGCCCGACTCGGAGCCGA
CATGGAGGATCTACGCAACCGACTCGGGCAGTACCGCAACGAGGTGCACACCATGCTGGGCCAGAGCACA
GAGGAGATACGGGCGCGGCTCTCCACACACCTGCGCAAGATGCGCAAGCGCTTGATGCGGGATGCCGAGG
ATCTGCAGAAGCGCCTAGCTGTGTACAAGGCAGGGGCACGCGAGGGCGCCGAGCGCGGTGTGAGTGCCAT
CCGTGAGCGCCTGGGGCCTCTGGTGGAGCAAGGTCGCCAGCGCACTGCCAACCTAGGCGCTGGGGCCGCC
CAGCCTCTGCGCGATCGCGCCCAGGCTTTTGGTGACCGCATCCGAGGGCGGCTGGAGGAAGTGGGCAACC
AGGCCCGTGACCGCCTAGAGGAGGTGCGTGAGCACATGGAGGAGGTGCGCTCCAAGATGGAGGAACAGAC
CCAGCAAATACGCCTGCAGGCGGAGATCTTCCAGGCCCGCCTCAAGGGCTGGTTCGAGCCAATAGTGGAA
GACATGCATCGCCAGTGGGCAAACCTGATGGAGAAGATACAGGCCTCTGTGGCTACCAACCCCATCATCA
CCCCAGTGGCCCAGGAGAATCAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites AscI-MluI
ACCN NM_009696
Insert Size 936 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC028816, AAH28816
RefSeq Size 1104 bp
RefSeq ORF 936 bp
Locus ID 11816
UniProt ID P08226
Cytogenetics 7 9.94 cM
Summary This gene encodes a member of the apolipoprotein A1/A4/E family of proteins. This protein is involved in the transport of lipoproteins in the blood. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. Homozygous knockout mice for this gene accumulate high levels of cholesterol in the blood and develop atherosclerosis. Different alleles of this gene have been associated with either increased risk or a protective effect for Alzheimer's disease in human patients. This gene maps to chromosome 7 in a cluster with the related apolipoprotein C1, C2 and C4 genes. [provided by RefSeq, Apr 2015]
Transcript Variant: This variant (1) differs in the 5' UTR compared to variant 3. Variants 1-4 encode the same protein.
Write Your Own Review
You're reviewing:Apoe (NM_009696) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG227426 Apoe (tGFP-tagged) - Mouse apolipoprotein E (Apoe), (10ug) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
MR227426 Apoe (Myc-DDK-tagged) - Mouse apolipoprotein E (Apoe) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR227426L3 Lenti ORF clone of Apoe (Myc-DDK-tagged) - Mouse apolipoprotein E (Apoe) 10 ug
$600.00
MR227426L4 Lenti ORF clone of Apoe (mGFP-tagged) - Mouse apolipoprotein E (Apoe) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.