Aim2 (NM_001013779) Mouse Untagged Clone

SKU MC208091

Aim2 (untagged) - Mouse absent in melanoma 2 (Aim2), (10ug)

Product Data

• Type: Mouse Untagged Clone
• Target Symbol: Aim2
• Synonyms: Gm1313; Ifi210
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208091 representing NM_001013779; Red=Cloning site Blue=ORF; ; TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC; GCCGCGATCGCC; ; ATGGAGGTCACCAGTTCCTCAGTTGTGGTTGATGTTGAATCTAACCACGAAGTCCCAAATAACGTTGTTA; AGAGAGCCAGGGAAACTCCCAGGATTAGTAAACTGAAGATTCAGCCATGTGGAACAATTGTGAATGGGCT; GTTTAAAGTCCAGAAGATAACAGAGGAAAAAGATAGAGTACTATATGGTATACATGATAAAACAGGGACA; ATGGAGGTGTTGGTGCTGGGAAACCCAAGCAAAACAAAGTGCGAGGAAGGAGACAAGATTAGACTCACGT; TCTTTGAGGTGTCAAAAAATGGAGTGAAAATTCAGTTGAAATCTGGACCTTGTAGCTTTTTTAAGGTTAT; TAAGGCTGCAAAGCCAAAAACTGACATGAAAAGTGTGGAGTGA; ; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT; ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001013779
• Insert Size: 393 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.; ; The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: BC009664, AAH09664
• RefSeq Size: 1456 bp
• RefSeq ORF: 1065 bp
• Locus ID: 383619
• UniProt ID: Q91VJ1
• Cytogenetics: 1 H3
• Summary: Involved in innate immune response by recognizing cytosolic double-stranded DNA and inducing caspase-1-activating inflammasome formation in macrophages. Upon binding to DNA is thought to undergo oligomerization and to associate with PYCARD initiating the recruitment of caspase-1 precusrsor and processing of interleukin-1 beta and interleukin-18. Detects cytosolic dsDNA of viral and bacterial origin in a non-sequence-specific manner. Can also trigger PYCARD-dependent, caspase-1-independent cell death that involves caspase-8.[UniProtKB/Swiss-Prot Function]