Pou5f1 (NM_013633) Mouse Untagged Clone

SKU
MC208038
Pou5f1 (untagged) - Mouse POU domain, class 5, transcription factor 1 (Pou5f1), (10ug)
$503.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Pou5f1
Synonyms NF-A3; Oct; Oct-; Oct-3; Oct-3/; Oct-3/4; Oct-4; Oct3; Oct3/; Oct3/4; Oct4; Otf; Otf-; Otf-3; Otf-4; Otf3; Otf3-; Otf3-rs7; Otf3g; Otf4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208038 representing NM_013633
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGGACACCTGGCTTCAGACTTCGCCTTCTCACCCCCACCAGGTGGGGGTGATGGGTCAGCAGGGC
TGGAGCCGGGCTGGGTGGATCCTCGAACCTGGCTAAGCTTCCAAGGGCCTCCAGGTGGGCCTGGAATCGG
ACCAGGCTCAGAGGTATTGGGGATCTCCCCATGTCCGCCCGCATACGAGTTCTGCGGAGGGATGGCATAC
TGTGGACCTCAGGTTGGACTGGGCCTAGTCCCCCAAGTTGGCGTGGAGACTTTGCAGCCTGAGGGCCAGG
CAGGAGCACGAGTGGAAAGCAACTCAGAGGGAACCTCCTCTGAGCCCTGTGCCGACCGCCCCAATGCCGT
GAAGTTGGAGAAGGTGGAACCAACTCCCGAGGAGTCCCAGGACATGAAAGCCCTGCAGAAGGAGCTAGAA
CAGTTTGCCAAGCTGCTGAAGCAGAAGAGGATCACCTTGGGGTACACCCAGGCCGACGTGGGGCTCACCC
TGGGCGTTCTCTTTGGAAAGGTGTTCAGCCAGACCACCATCTGTCGCTTCGAGGCCTTGCAGCTCAGCCT
TAAGAACATGTGTAAGCTGCGGCCCCTGCTGGAGAAGTGGGTGGAGGAAGCCGACAACAATGAGAACCTT
CAGGAGATATGCAAATCGGAGACCCTGGTGCAGGCCCGGAAGAGAAAGCGAACTAGCATTGAGAACCGTG
TGAGGTGGAGTCTGGAGACCATGTTTCTGAAGTGCCCGAAGCCCTCCCTACAGCAGATCACTCACATCGC
CAATCAGCTTGGGCTAGAGAAGGATGTGGTTCGAGTATGGTTCTGTAACCGGCGCCAGAAGGGCAAAAGA
TCAAGTATTGAGTATTCCCAACGAGAAGAGTATGAGGCTACAGGGACACCTTTCCCAGGGGGGGCTGTAT
CCTTTCCTCTGCCCCCAGGTCCCCACTTTGGCACCCCAGGCTATGGAAGCCCCCACTTCACCACACTCTA
CTCAGTCCCTTTTCCTGAGGGCGAGGCCTTTCCCTCTGTTCCCGTCACTGCTCTGGGCTCTCCCATGCAT
TCAAACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_013633
Insert Size 1059 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_013633.3, NP_038661.2
RefSeq Size 1353 bp
RefSeq ORF 1059 bp
Locus ID 18999
UniProt ID P20263
Cytogenetics 17 18.69 cM
Summary The protein encoded by this gene belongs to the POU domain family of transcription factors. POU domain transcription factors bind to a specific octamer DNA motif and regulate cell type-specific differentiation pathways. The encoded protein plays a key role in embryonic development and stem cell pluripotency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:Pou5f1 (NM_013633) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG205861 POU5F1/OCT4 (tGFP-tagged) - Mouse POU domain, class 5, transcription factor 1 (POU5F1/OCT4) 10 ug
$489.00 MSRP $657.00 MSRP $657.00
MR205861 Pou5f1 (Myc-DDK-tagged) - Mouse POU domain, class 5, transcription factor 1 (Pou5f1) 10 ug
$289.00 MSRP $457.00 MSRP $457.00
MR205861L3 Lenti ORF clone of Pou5f1 (Myc-DDK-tagged) - Mouse POU domain, class 5, transcription factor 1 (Pou5f1) 10 ug
$757.00
MR205861L4 Lenti ORF clone of Pou5f1 (mGFP-tagged) - Mouse POU domain, class 5, transcription factor 1 (Pou5f1) 10 ug
$757.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.