Pdgfa (NM_008808) Mouse Untagged Clone

SKU
MC208036
Pdgfa (untagged) - Mouse platelet derived growth factor, alpha (Pdgfa), (10ug)
$300.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Pdgfa
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208036 representing NM_008808
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGGACCTGGGCTTGCCTGCTGCTCCTCGGCTGCGGATACCTCGCCCATGCCCTGGCCGAGGAAGCCG
AGATACCCCGGGAGTTGATCGAGCGGCTGGCTCGAAGTCAGATCCACAGCATCCGGGACCTCCAGCGACT
CTTGGAGATAGACTCCGTAGGGGCTGAGGATGCCTTGGAGACAAGCCTGAGAGCCCATGGGTCCCATGCC
ATTAACCATGTGCCCGAGAAGCGGCCTGTGCCCATTCGCAGGAAGAGAAGTATTGAGGAAGCCATTCCCG
CAGTTTGCAAGACCAGGACGGTCATTTACGAGATACCTCGGAGCCAGGTGGACCCCACATCGGCCAACTT
CCTGATCTGGCCCCCATGTGTGGAGGTGAAGCGCTGCACTGGCTGTTGTAACACCAGCAGCGTCAAGTGC
CAGCCTTCACGGGTCCACCACCGCAGTGTCAAGGTGGCCAAAGTGGAGTATGTCAGGAAGAAGCCAAAAT
TGAAAGAGGTCCAGGTGAGGTTAGAGGAACACCTGGAGTGTGCATGTGCGACCTCCAACCTGAACCCAGA
CCATCGGGAGGAGGAGACAGATGTGAGGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI
ACCN NM_008808
Insert Size 591 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_008808.3, NP_032834.1
RefSeq Size 1019 bp
RefSeq ORF 591 bp
Locus ID 18590
UniProt ID P20033
Cytogenetics 5 77.65 cM
Summary Growth factor that plays an essential role in the regulation of embryonic development, cell proliferation, cell migration, survival and chemotaxis. Potent mitogen for cells of mesenchymal origin. Required for normal lung alveolar septum formation during embryogenesis, normal development of the gastrointestinal tract, normal development of Leydig cells and spermatogenesis. Required for normal oligodendrocyte development and normal myelination in the spinal cord and cerebellum. Plays an important role in wound healing. Signaling is modulated by the formation of heterodimers with PDGFB.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Pdgfa (NM_008808) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG201931 Pdgfa (tGFP-tagged) - Mouse platelet derived growth factor, alpha (Pdgfa) 10 ug
$500.00
MR201931 Pdgfa (Myc-DDK-tagged) - Mouse platelet derived growth factor, alpha (Pdgfa) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR201931L3 Lenti ORF clone of Pdgfa (Myc-DDK-tagged) - Mouse platelet derived growth factor, alpha (Pdgfa) 10 ug
$600.00
MR201931L4 Lenti ORF clone of Pdgfa (mGFP-tagged) - Mouse platelet derived growth factor, alpha (Pdgfa) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.