Cd38 (NM_007646) Mouse Untagged Clone

SKU
MC208001
Cd38 (untagged) - Mouse CD38 antigen (Cd38), (10ug)
$450.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Cd38
Synonyms ADPRC 1; Cd38-r; Cd38-rs1; I-19
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208001 representing NM_007646
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTAACTATGAATTTAGCCAGGTGTCTGGGGACAGACCTGGCTGCCGCCTCTCTAGGAAAGCCCAGA
TCGGTCTCGGAGTGGGTCTCCTGGTCCTGATCGCCTTGGTAGTAGGGATCGTGGTCATACTTCTGAGGCC
GCGCTCACTCCTGGTGTGGACTGGAGAGCCTACCACGAAGCACTTTTCTGACATCTTCCTGGGACGCTGC
CTCATCTACACTCAGATCCTCCGGCCGGAGATGAGAGATCAGAACTGCCAGGAGATACTGAGTACATTCA
AAGGAGCATTTGTTTCCAAGAACCCTTGCAACATCACAAGAGAAGACTACGCCCCACTTGTTAAATTGGT
CACTCAAACCATACCATGTAACAAGACTCTCTTTTGGAGCAAATCCAAACACCTGGCCCATCAATATACT
TGGATCCAGGGAAAGATGTTCACCCTGGAGGACACCCTGCTGGGCTACATTGCTGATGATCTCAGGTGGT
GTGGAGACCCTAGTACTTCTGATATGAACTATGTCTCTTGCCCACATTGGAGTGAAAACTGTCCCAACAA
CCCTATTACTGTGTTCTGGAAAGTGATTTCCCAAAAGTTTGCAGAAGATGCCTGTGGTGTGGTCCAAGTG
ATGCTCAATGGGTCCCTCCGTGAGCCATTTTACAAAAACAGCACCTTTGGAAGTGTGGAAGTCTTTAGTT
TGGACCCAAATAAGGTTCATAAACTACAGGCCTGGGTGATGCACGACATCGAAGGAGCTTCCAGTAACGC
ATGTTCAAGCTCCTCCTTAAATGAGCTGAAGATGATTGTGCAGAAAAGGAATATGATATTTGCCTGCGTG
GATAACTACAGGCCTGCCAGGTTTCTTCAGTGTGTGAAGAACCCTGAGCACCCATCGTGTAGACTTAATA
CGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_007646
Insert Size 915 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC046312, AAH46312
RefSeq Size 2797 bp
RefSeq ORF 915 bp
Locus ID 12494
UniProt ID P56528
Cytogenetics 5 23.85 cM
Summary This gene encodes a non-lineage-restricted, type II transmembrane glycoprotein that synthesizes and hydrolyzes cyclic adenosine 5'-diphosphate-ribose, an intracellular calcium ion mobilizing messenger. The release of soluble protein and the ability of membrane-bound protein to become internalized indicate both extracellular and intracellular functions for the protein. This protein has an N-terminal cytoplasmic tail, a single membrane-spanning domain, and a C-terminal extracellular region with four N-glycosylation sites. Knockout mice deficient for this gene display altered humoral immune responses. In addition, knockout mice exhibit higher locomotor activity and defects in nurturing and social behaviors. [provided by RefSeq, Sep 2015]
Write Your Own Review
You're reviewing:Cd38 (NM_007646) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG204265 Cd38 (tGFP-tagged) - Mouse CD38 antigen (Cd38) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
MR204265 Cd38 (Myc-DDK-tagged) - Mouse CD38 antigen (Cd38) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR204265L1 Lenti ORF clone of Cd38 (Myc-DDK-tagged) - Mouse CD38 antigen (Cd38) 10 ug
$600.00
MR204265L2 Lenti ORF clone of Cd38 (mGFP-tagged) - Mouse CD38 antigen (Cd38) 10 ug
$600.00
MR204265L3 Lenti ORF clone of Cd38 (Myc-DDK-tagged) - Mouse CD38 antigen (Cd38) 10 ug
$600.00
MR204265L4 Lenti ORF clone of Cd38 (mGFP-tagged) - Mouse CD38 antigen (Cd38) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.