Casp1 (NM_009807) Mouse Untagged Clone

SKU
MC207999
Casp1 (untagged) - Mouse caspase 1 (Casp1), (10ug)
$686.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Casp1
Synonyms ICE; Il1bc
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207999 representing NM_009807
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGACAAGATCCTGAGGGCAAAGAGGAAGCAATTTATCAACTCAGTGAGTATAGGGACAATAAATG
GATTGTTGGATGAACTTTTAGAGAAGAGAGTGCTGAATCAGGAAGAAATGGATAAAATAAAACTTGCAAA
CATTACTGCTATGGACAAGGCACGGGACCTATGTGATCATGTCTCTAAAAAAGGGCCCCAGGCAAGCCAA
ATCTTTATCACTTACATTTGTAATGAAGACTGCTACCTGGCAGGAATTCTGGAGCTTCAATCAGCTCCAT
CAGCTGAAACATTTGTTGCTACAGAAGATTCTAAAGGAGGACATCCTTCATCCTCAGAAACAAAGGAAGA
ACAGAACAAAGAAGATGGCACATTTCCAGGACTGACTGGGACCCTCAAGTTTTGCCCTTTAGAAAAAGCC
CAGAAGTTATGGAAAGAAAATCCTTCAGAGATTTATCCAATAATGAATACAACCACTCGTACACGTCTTG
CCCTCATTATCTGCAACACAGAGTTTCAACATCTTTCTCCGAGGGTTGGAGCTCAAGTTGACCTCAGAGA
AATGAAGTTGCTGCTGGAGGATCTGGGGTATACCGTGAAAGTGAAAGAAAATCTCACAGCTCTGGAGATG
GTGAAAGAGGTGAAAGAATTTGCTGCCTGCCCAGAGCACAAGACTTCTGACAGTACTTTCCTTGTATTCA
TGTCTCATGGTATCCAGGAGGGAATATGTGGGACCACATACTCTAATGAAGTTTCAGATATTTTAAAGGT
TGACACAATCTTTCAGATGATGAACACTTTGAAGTGCCCAAGCTTGAAAGACAAGCCCAAGGTGATCATT
ATTCAGGCATGCCGTGGAGAGAAACAAGGAGTGGTGTTGTTAAAAGATTCAGTAAGAGACTCTGAAGAGG
ATTTCTTAACGGATGCAATTTTTGAAGATGATGGCATTAAGAAGGCCCATATAGAGAAAGATTTTATTGC
TTTCTGCTCTTCAACACCAGATAATGTGTCTTGGAGACATCCTGTCAGGGGCTCACTTTTCATTGAGTCA
CTCATCAAACACATGAAAGAATATGCCTGGTCTTGTGACTTGGAGGACATTTTCAGAAAGGTTCGATTTT
CATTTGAACAACCAGAATTTAGGCTACAGATGCCCACTGCTGATAGGGTGACCCTGACAAAACGTTTCTA
CCTCTTCCCGGGACATTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI
ACCN NM_009807
Insert Size 1209 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC008152, AAH08152
RefSeq Size 1533 bp
RefSeq ORF 1209 bp
Locus ID 12362
UniProt ID P29452
Cytogenetics 9 2.46 cM
Summary Thiol protease that cleaves IL-1 beta between an Asp and an Ala, releasing the mature cytokine which is involved in a variety of inflammatory processes. Important for defense against pathogens. Cleaves and activates sterol regulatory element binding proteins (SREBPs). Can also promote apoptosis (By similarity). Upon inflammasome activation, during DNA virus infection but not RNA virus challenge, controls antiviral immunity through the cleavage of CGAS, rendering it inactive (PubMed:28314590). In apoptotic cells, cleaves SPHK2 which is released from cells and remains enzymatically active extracellularly (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Casp1 (NM_009807) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG227666 Casp1 (tGFP-tagged) - Mouse caspase 1 (Casp1), (10ug) 10 ug
$886.00
MR227666 Casp1 (Myc-DDK-tagged) - Mouse caspase 1 (Casp1) 10 ug
$686.00
MR227666L3 Lenti ORF clone of Casp1 (Myc-DDK-tagged) - Mouse caspase 1 (Casp1) 10 ug
$986.00
MR227666L4 Lenti ORF clone of Casp1 (mGFP-tagged) - Mouse caspase 1 (Casp1) 10 ug
$986.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.