Pnpla3 (NM_054088) Mouse Untagged Clone

SKU
MC207847
Pnpla3 (untagged) - Mouse patatin-like phospholipase domain containing 3 (Pnpla3), (10ug)
$457.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Pnpla3
Synonyms Adpn
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_054088, the custom clone sequence may differ by one or more nucleotides


ATGTATGACCCAGAGCGCCGCTGGAGCCTGTCGTTTGCAGGCTGCGGCTTCCTGGGCTTCTACCACGTCG
GGGCTACGCTATGTCTGAGCGAGCGCGCCCCGCACCTCCTCCGCGATGCGCGCACTTTCTTTGGCTGCTC
GGCCGGTGCACTGCACGCGGTCACCTTCGTGTGCAGTCTCCCTCTCGGCCGTATAATGGAGATCCTCATG
GACCTCGTGCGGAAAGCCAGGAGCCGCAACATCGGCACCCTCCACCCGTTCTTCAACATTAACAAGTGCA
TCAGAGACGGGCTCCAGGAGAGCCTCCCAGACAATGTCCACCAGGTCATTTCTGGCAAGGTTCACATCTC
ACTCACCAGGGTGTCGGATGGGGAGAACGTGCTGGTGTCTGAGTTCCATTCCAAAGACGAAGTCGTGGAT
GCCCTGGTGTGTTCCTGCTTCATTCCCCTCTTCTCTGGCCTAATCCCTCCTTCCTTCCGAGGCGAGCGGT
ACGTGGACGGAGGAGTGAGCGACAACGTCCCTGTGCTGGATGCCAAAACCACCATCACGGTGTCACCTTT
CTACGGTGAGCATGACATCTGCCCCAAAGTCAAGTCCACCAACTTCTTCCACGTGAATATCACCAACCTC
AGCCTCCGCCTCTGCACTGGGAACCTCCAACTTCTGACCAGAGCGCTCTTCCCGTCTGATGTGAAGGTGA
TGGGAGAGCTGTGCTATCAAGGGTACCTGGACGCCTTCCGGTTCCTGGAGGAGAATGGCATCTGTAACGG
GCCACAGCGCAGCCTGAGTCTGTCCTTGGTGGCGCCAGAAGCCTGCTTGGAAAATGGCAAACTTGTGGGA
GACAAGGTGCCAGTCAGCCTATGCTTTACAGATGAGAACATCTGGGAGACACTGTCCCCCGAGCTCAGCA
CAGCTCTGAGTGAAGCGATTAAGGACAGGGAGGGCTACCTGAGCAAAGTCTGCAACCTCCTGCCCGTCAG
GATCCTGTCCTACATCATGCTGCCCTGCAGTCTGCCCGTGGAGTCGGCTATCGCTGCAGTCCACAGGCTG
GTGACATGGCTCCCTGATATCCAGGATGATATCCAGTGGCTACAATGGGCGACATCCCAGGTTTGTGCCC
GAATGACGATGTGCCTGCTCCCCTCTACCAGATCCCGAGCATCCAAGGATGACCATCGAATGCTCAAGCA
TGGCCATCACCCATCTCCCCACAAGCCTCAAGGCAACTCTGCTGGTTTGTAA


Restriction Sites SgfI-MluI
ACCN NM_054088
Insert Size 1242 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC028792, AAH28792
RefSeq Size 1915 bp
RefSeq ORF 1155 bp
Locus ID 116939
UniProt ID Q91WW7
Cytogenetics 15 E2
Summary Specifically catalyzes coenzyme A (CoA)-dependent acylation of 1-acyl-sn-glycerol 3-phosphate (2-lysophosphatidic acid/LPA) to generate phosphatidic acid (PA), an important metabolic intermediate and precursor for both triglycerides and glycerophospholipids. Does not esterify other lysophospholipids. Acyl donors are long chain (at least C16) fatty acyl-CoAs: arachidonoyl-CoA, linoleoyl-CoA, oleoyl-CoA and at a lesser extent palmitoyl-CoA (PubMed:22560221). Additionally possesses low triacylglycerol lipase and CoA-independent acylglycerol transacylase activities and thus may play a role in acyl-chain remodeling of triglycerides (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Pnpla3 (NM_054088) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG206522 Pnpla3 (tGFP-tagged) - Mouse patatin-like phospholipase domain containing 3 (Pnpla3) 10 ug
$657.00
MR206522 Pnpla3 (Myc-DDK-tagged) - Mouse patatin-like phospholipase domain containing 3 (Pnpla3) 10 ug
$289.00 MSRP $457.00 MSRP $457.00
MR206522L3 Lenti ORF clone of Pnpla3 (Myc-DDK-tagged) - Mouse patatin-like phospholipase domain containing 3 (Pnpla3) 10 ug
$757.00
MR206522L4 Lenti ORF clone of Pnpla3 (mGFP-tagged) - Mouse patatin-like phospholipase domain containing 3 (Pnpla3) 10 ug
$757.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.