Rab27b (NM_030554) Mouse Untagged Clone

SKU
MC207782
Rab27b (untagged) - Mouse RAB27b, member RAS oncogene family (Rab27b), transcript variant 1, (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Rab27b
Synonyms 2310021G14Rik; B130064M09Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207782 representing NM_030554
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACTGATGGAGACTATGATTATCTGATTAAACTCCTGGCCCTTGGAGACTCAGGAGTCGGGAAGACAA
CATTTCTCTATAGATACACAGACAATAAATTCAATCCCAAATTCATCACCACAGTGGGAATAGATTTTCG
GGAAAAACGTGTGGTTTATGACACACAAGGAGCAGATGGAGCGTCAGGAAAAGCGTTTAAGGTACATCTG
CAGCTTTGGGACACTGCTGGACAAGAGCGGTTCCGGAGCCTTACCACTGCCTTCTTCAGAGATGCCATGG
GCTTCTTACTGATGTTTGACCTCACCAGTCAACAGAGCTTCTTGAATGTCAGAAACTGGATGAGTCAACT
GCAGGCAAATGCTTACTGTGAAAACCCAGACATAGTATTAATTGGCAACAAGGCAGACCTGCCAGACCAA
AGGGAAGTCAATGAACGGCAAGCACGGGAGCTGGCTGAAAAATATGGCATACCATACTTCGAAACAAGCG
CAGCTACAGGACAGAATGTAGAGAAGTCAGTGGAAACGCTTCTGGACTTAATCATGAAGAGAATGGAAAA
GTGTGTAGAGAAGACACAGGTTCCGGACACTGTCAATGGAGGAAATTCTGGAAAGCTGGATGGGGAAAAG
CCAGCAGAAAAGAAATGTGCCTGCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_030554
Insert Size 657 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_030554.4, NP_085031.3
RefSeq Size 7212 bp
RefSeq ORF 657 bp
Locus ID 80718
UniProt ID Q99P58
Cytogenetics 18 43.89 cM
Summary Plays a role in NTRK2/TRKB axonal anterograde transport by facilitating the associaton of NTRK2/TRKB with KLC1. May be involved in targeting uroplakins to urothelial apical membranes.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (1). Variants 1, 2, and 3 encode the same protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:Rab27b (NM_030554) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MR202445 Rab27b (Myc-DDK-tagged) - Mouse RAB27b, member RAS oncogene family (Rab27b), transcript variant 1 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR202445L3 Lenti ORF clone of Rab27b (Myc-DDK-tagged) - Mouse RAB27b, member RAS oncogene family (Rab27b), transcript variant 1 10 ug
$600.00
MR202445L4 Lenti ORF clone of Rab27b (mGFP-tagged) - Mouse RAB27b, member RAS oncogene family (Rab27b), transcript variant 1 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.