Stk16 (NM_011494) Mouse Untagged Clone

SKU
MC207409
Stk16 (untagged) - Mouse serine/threonine kinase 16 (Stk16), (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Stk16
Synonyms EDPK; Krct; MPSK; PKL12; TSF-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207409 representing NM_011494
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCCACGCACTGTGTGTCTGCTCCCGGGGAACTGTCATCATTGACAATAAGCGTTACCTCTTCGTCC
AGAAATTGGGGGAAGGTGGATTCAGCTATGTGGACCTAGTGGAGGGCTTGCATGATGGACACTTCTACGC
CCTGAAGCGGATCCTGTGCCATGAGCAGCAAGACCAGGAAGAAGCCCAACGAGAGGCAGAGATGCATCGC
CTCTTCCAGCATCCCAACATCCTTCGCCTCATGGCTTACTCTCTGAAAGAACGAGGTGCTAAGCATGAAG
CCTGGCTGCTGCTGCCCTTCTTCAAGAAAGGTACACTGTGGAATGAGATAGAAAGGCTGAAGGACCAAGG
CAGCTTCCTGACTGAAGACCAGATCCTGCCGCTGTTGCTGGGTATCAGCAGAGGCCTTGAGGCTATTCAT
GCCAAAGGTTATGCACACAGGGACCTGAAGCCCACCAATATTTTGCTTGGTGATGAGGGGCAGCCAGTTT
TAATGGACTTGGGTTCTATGAATCAAGCATGCATTCAAGTGGAGGGCTCTCGCCAGGCACTAGCTCTTCA
GGACTGGGCAGCTCAGCGGTGCACCATCTCCTACCGGGCACCTGAACTTTTTTCTGTGCAAAGCCACTGT
GTCATCGATGAGCGGACTGATGTCTGGTCCCTAGGCTGTGTGCTTTATGCCATGATGTTTGGGGAAGGCC
CTTACGATATGGTGTTCCAGAAGGGTGACAGTGTGGCCCTTGCTGTGCAGAATGAACTCAGCATCCCACA
AAGCCCCAGGCATTCTTCAGCATTGCGACAGCTATTGTCTTCTATGATGACTGTGGACCCCCAGCAGAGG
CCTCACATCCCTGTCCTCCTCAGTCAGTTGGAGGCATTGCAGCCACCAGCTCCTGGCCAGCACACCACCC
AAATCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_011494
Insert Size 918 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_011494.5, NP_035624.3
RefSeq Size 2885 bp
RefSeq ORF 918 bp
Locus ID 20872
UniProt ID O88697
Cytogenetics 1 C4
Summary Membrane-associated protein kinase that phosphorylates on serine and threonine residues. In vitro substrates include DRG1, ENO1 and EIF4EBP1. Also autophosphorylates (By similarity). May be involved in secretory vesicle trafficking or intracellular signaling. May have a role in regulating stromal-epithelial interactions that occur during ductal morphogenesis in the mammary gland. May be involved in TGF-beta signaling. Able to autophosphorylate on Tyr residue; it is however unclear whether it has tyrosine-protein kinase toward other proteins.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript. Both variants 1 and 2 encode the same protein.
Write Your Own Review
You're reviewing:Stk16 (NM_011494) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG204293 Stk16 (tGFP-tagged) - Mouse serine/threonine kinase 16 (Stk16) 10 ug
$500.00
MR204293 Stk16 (Myc-DDK-tagged) - Mouse serine/threonine kinase 16 (Stk16) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR204293L3 Lenti ORF clone of Stk16 (Myc-DDK-tagged) - Mouse serine/threonine kinase 16 (Stk16) 10 ug
$600.00
MR204293L4 Lenti ORF clone of Stk16 (mGFP-tagged) - Mouse serine/threonine kinase 16 (Stk16) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.