Rab7 (NM_009005) Mouse Untagged Clone

SKU
MC207372
Rab7 (untagged) - Mouse RAB7, member RAS oncogene family (Rab7), (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Rab7
Synonyms Rab7a
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207372 representing NM_009005
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCTCTAGGAAGAAAGTGTTGCTGAAGGTCATCATCCTGGGGGACTCTGGTGTTGGAAAGACCTCTC
TCATGAACCAGTATGTGAACAAGAAGTTCAGTAACCAGTACAAAGCCACAATAGGAGCGGACTTTCTGAC
CAAGGAGGTGATGGTGGACGACAGACTTGTTACCATGCAGATCTGGGACACAGCCGGTCAAGAACGGTTC
CAGTCTCTTGGTGTGGCCTTCTACAGAGGTGCAGATTGCTGTGTTCTGGTGTTTGATGTGACTGCCCCCA
ACACTTTCAAAACCCTCGACAGCTGGAGAGACGAGTTTCTCATCCAGGCCAGCCCCCGGGATCCCGAGAA
CTTCCCTTTTGTTGTGTTGGGAAACAAGATTGACCTGGAAAACAGACAAGTGGCCACAAAGAGGGCACAG
GCTTGGTGCTACAGCAAAAACAACATTCCTTACTTCGAGACCAGTGCCAAGGAGGCCATCAATGTGGAGC
AGGCCTTCCAGACAATTGCTCGGAATGCCCTTAAACAGGAAACAGAAGTGGAACTGTACAATGAATTCCC
TGAACCCATCAAACTGGACAAGAATGACCGGGCCAAGGCCTCCGCAGAAAGCTGCAGTTGTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_009005
Insert Size 624 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_009005.3, NP_033031.2
RefSeq Size 2173 bp
RefSeq ORF 624 bp
Locus ID 19349
UniProt ID P51150
Cytogenetics 6 39.13 cM
Summary Key regulator in endo-lysosomal trafficking. Governs early-to-late endosomal maturation, microtubule minus-end as well as plus-end directed endosomal migration and positioning, and endosome-lysosome transport through different protein-protein interaction cascades. Plays a central role, not only in endosomal traffic, but also in many other cellular and physiological events, such as growth-factor-mediated cell signaling, nutrient-transportor mediated nutrient uptake, neurotrophin transport in the axons of neurons and lipid metabolism. Also involved in regulation of some specialized endosomal membrane trafficking, such as maturation of melanosomes, pathogen-induced phagosomes (or vacuoles) and autophagosomes. Plays a role in the maturation and acidification of phagosomes that engulf pathogens, such as S.aureus and Mycobacteria. Plays a role in the fusion of phagosomes with lysosomes. Plays important roles in microbial pathogen infection and survival, as well as in participating in the life cycle of viruses. Microbial pathogens possess survival strategies governed by RAB7A, sometimes by employing RAB7A function (e.g. Salmonella) and sometimes by excluding RAB7A function (e.g. Mycobacterium). In concert with RAC1, plays a role in regulating the formation of RBs (ruffled borders) in osteoclasts. Controls the endosomal trafficking and neurite outgrowth signaling of NTRK1/TRKA. Regulates the endocytic trafficking of the EGF-EGFR complex by regulating its lysosomal degradation (By similarity). Involved in the ADRB2-stimulated lipolysis through lipophagy, a cytosolic lipase-independent autophagic pathway (PubMed:23708524). Required for the exosomal release of SDCBP, CD63 and syndecan (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1, 2, 3, 4, and 5 encode the same protein.
Write Your Own Review
You're reviewing:Rab7 (NM_009005) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG202190 Rab7 (tGFP-tagged) - Mouse RAB7, member RAS oncogene family (Rab7) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
MR202190 Rab7 (Myc-DDK-tagged) - Mouse RAB7, member RAS oncogene family (Rab7) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR202190L3 Lenti ORF clone of Rab7 (Myc-DDK-tagged) - Mouse RAB7, member RAS oncogene family (Rab7) 10 ug
$600.00
MR202190L4 Lenti ORF clone of Rab7 (mGFP-tagged) - Mouse RAB7, member RAS oncogene family (Rab7) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.