Rab11b (NM_008997) Mouse Untagged Clone
Product Data | |
Type | Mouse Untagged Clone |
---|---|
Target Symbol | Rab11b |
Synonyms | A730055L17Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>MC207370 representing NM_008997
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGACCCGGGACGACGAGTACGATTACCTATTCAAAGTGGTGCTTATTGGGGACTCAGGTGTAGGTA AGAGCAACCTGCTGTCACGCTTCACCAGAAACGAATTCAACCTAGAGAGCAAGAGTACCATCGGAGTGGA GTTCGCCACTCGCAGCATTCAGGTGGACGGCAAGACCATCAAGGCTCAGATCTGGGACACTGCTGGCCAG GAGCGCTACCGTGCCATTACCTCTGCGTACTACCGTGGTGCAGTGGGTGCACTGCTGGTATATGACATTG CCAAGCACTTGACATATGAGAACGTGGAGCGCTGGCTGAAGGAGCTGCGGGATCATGCAGATAGCAACAT TGTCATCATGCTGGTGGGCAACAAGAGTGACCTGCGCCACCTTCGGGCTGTGCCCACTGATGAGGCCCGT GCCTTTGCAGAAAAGAACAACTTGTCCTTCATTGAGACCTCAGCCTTGGATTCCACCAATGTAGAGGAAG CATTCAAGAACATCCTCACAGAAATCTACCGTATTGTGTCACAGAAGCAAATCGCTGACCGTGCAGCCCA CGATGAGTCCCCTGGCAACAACGTGGTGGACATCAGTGTGCCACCCACCACCGATGGACAGAGACCCAAC AAGCTGCAGTGCTGCCAGAGCCTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_008997 |
Insert Size | 657 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_008997.3, NP_033023.1 |
RefSeq Size | 6065 bp |
RefSeq ORF | 657 bp |
Locus ID | 19326 |
UniProt ID | P46638 |
Cytogenetics | 17 17.98 cM |
Summary | The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different set of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. The small Rab GTPase RAB11B plays a role in endocytic recycling, regulating apical recycling of several transmembrane proteins including cystic fibrosis transmembrane conductance regulator/CFTR, epithelial sodium channel/ENaC, potassium voltage-gated channel, and voltage-dependent L-type calcium channel. May also regulate constitutive and regulated secretion, like insulin granule exocytosis. Required for melanosome transport and release from melanocytes. Also regulates V-ATPase intracellular transport in response to extracellular acidosis.[UniProtKB/Swiss-Prot Function] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
MR202439 | Rab11b (Myc-DDK-tagged) - Mouse RAB11B, member RAS oncogene family (Rab11b) | 10 ug |
$289.00
MSRP
$300.00
MSRP
$300.00
|
|
MR202439L3 | Lenti ORF clone of Rab11b (Myc-DDK-tagged) - Mouse RAB11B, member RAS oncogene family (Rab11b) | 10 ug |
$600.00
|
|
MR202439L4 | Lenti ORF clone of Rab11b (mGFP-tagged) - Mouse RAB11B, member RAS oncogene family (Rab11b) | 10 ug |
$600.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.