Jazf1 (NM_001168277) Mouse Untagged Clone

SKU
MC207175
Jazf1 (untagged) - Mouse JAZF zinc finger 1 (Jazf1), transcript variant 2, (10ug)
$330.00
2 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Jazf1
Synonyms AI591476; C820002C15; Jaz1; Tip27
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207175 representing NM_001168277
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACAGATGCTGCACGCCGAGAACAGGAATCTCTGAAGAAGAAGATTCAGCCGAAGCTTTCACTAACCC
TGTCCAGCTCCGTGTCTCGAGGGAATGTGTCCACTCCACCTCGACATAGCAGTGGCAGCCTTACTCCCCC
TGTGACCCCGCCCATCACGCCCTCCTCTTCATTCCGCAGCAGCACTCCAACAGGCAGCGAGTATGATGAG
GAAGAGGTGGACTATGAGGAGTCAGACAGTGATGAGTCCTGGACCACAGAGAGCGCCATCAGCTCTGAAG
CAATCCTCAGCTCCATGTGCATGAATGGAGGGGAAGAGAAGCCTTTCGCCTGCCCAGTTCCAGGGTGTAA
AAAGAGATACAAGAATGTGAATGGCATAAAGTACCATGCTAAGAATGGTCACCGAACACAGATTCGCGTC
CGCAAACCATTCAAATGCCGGTGTGGGAAGAGTTACAAGACAGCTCAGGGCCTGCGGCACCACACAATCA
ATTTCCATCCCCCAGTGTCTGCCGAGATGATCAGGAAGATGCAGCAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_001168277
Insert Size 540 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001168277.1, NP_001161749.1
RefSeq Size 2926 bp
RefSeq ORF 540 bp
Locus ID 231986
UniProt ID Q80ZQ5
Cytogenetics 6 25.74 cM
Summary Acts as a transcriptional corepressor of orphan nuclear receptor NR2C2 (By similarity). Inhibits expression of the gluconeogenesis enzyme PCK2 through inhibition of NR2C2 activity (PubMed:24380856). Also involved in transcriptional activation of NAMPT by promoting expression of PPARA and PPARD (PubMed:24930994). Plays a role in lipid metabolism by suppressing lipogenesis, increasing lipolysis and decreasing lipid accumulation in adipose tissue (PubMed:24380856, PubMed:25614086). Plays a role in glucose homeostasis by improving glucose metabolism and insulin sensitivity (PubMed:25614086, PubMed:24380856).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:Jazf1 (NM_001168277) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MR201591 Jazf1 (Myc-DDK-tagged) - Mouse JAZF zinc finger 1 (Jazf1), transcript variant 2 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR201591L3 Lenti ORF clone of Jazf1 (Myc-DDK-tagged) - Mouse JAZF zinc finger 1 (Jazf1), transcript variant 2 10 ug
$600.00
MR201591L4 Lenti ORF clone of Jazf1 (mGFP-tagged) - Mouse JAZF zinc finger 1 (Jazf1), transcript variant 2 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.