Tnfrsf19 (BC030062) Mouse Untagged Clone

SKU
MC207078
Tnfrsf19 (untagged) - Mouse tumor necrosis factor receptor superfamily, member 19 (cDNA clone MGC:40996 IMAGE:5256883), (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Tnfrsf19
Synonyms TAJ, Troy, TAJ-ALPHA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC030062
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCACTCAAGGTCCTACCTCTACACAGGACGGTGCTCTTCGCTGCCATTCTCTTCCTACTCCACCTGG
CATGTAAAGTGAGTTGCGAAACCGGAGATTGCAGGCAGCAGGAATTCAAGGATCGATCTGGAAACTGTGT
CCTCTGCAAACAGTGCGGACCTGGCATGGAGTTGTCCAAGGAATGTGGCTTCGGCTATGGGGAGGATGCA
CAGTGTGTGCCCTGCAGGCCGCACCGGTTCAAGGAAGACTGGGGTTTCCAGAAGTGTAAGCCATGTGCGG
ACTGTGCGCTGGTGAACCGCTTTCAGAGGGCCAACTGCTCACACACCAGTGATGCTGTCTGCGGGGACTG
CCTGCCAGGATTTTACCGGAAGACCAAACTGGTTGGTTTTCAAGACATGGAGTGTGTGCCCTGCGGAGAC
CCACCTCCTCCCTACGAACCACACTGTACCAGCAAGGTGAACCTTGTGAAGATCTCCTCCACCGTCTCCA
GCCCTCGGGACACGGCGCTGGCTGCCGTCATCTGCAGTGCTCTGGCCACGGTGCTGCTCGCCCTGCTCAT
CCTGTGTGTCATCTACTGCAAGAGGCAGTTCATGGAGAAGAAACCCAGCTGTAAGCTCCCATCCCTCTGT
CTCACTGTGAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI
ACCN BC030062
Insert Size 645 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC030062, AAH30062
RefSeq Size 1271 bp
RefSeq ORF 644 bp
Locus ID 29820
Cytogenetics 14 D1
Summary Can mediate activation of c-Jun and NF-kappa-B. May promote caspase-independent cell death (By similarity). Isoform 2 and isoform 3 may act as decoy receptors.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Tnfrsf19 (BC030062) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG202344 Tnfrsf19 (tGFP-tagged) - Mouse tumor necrosis factor receptor superfamily, member 19 (cDNA clone MGC:40996 IMAGE:5256883) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
MR202344 Tnfrsf19 (Myc-DDK-tagged) - Mouse tumor necrosis factor receptor superfamily, member 19 (cDNA clone MGC:40996 IMAGE:5256883) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR202344L3 Lenti ORF clone of Tnfrsf19 (Myc-DDK-tagged) - Mouse tumor necrosis factor receptor superfamily, member 19 (cDNA clone MGC:40996 IMAGE:5256883) 10 ug
$600.00
MR202344L4 Lenti ORF clone of Tnfrsf19 (mGFP-tagged) - Mouse tumor necrosis factor receptor superfamily, member 19 (cDNA clone MGC:40996 IMAGE:5256883) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.