Tmem254a (NM_026679) Mouse Untagged Clone

SKU
MC206889
Tmem254a (untagged) - Mouse DNA segment, Chr 14, ERATO Doi 449, expressed (D14Ertd449e), transcript variant 1, (10ug)
$165.00
2 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Tmem254a
Synonyms 0610008K04Rik; 0610010A22Rik; AA960404; D14Ertd449e; Tmem254
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC206889 representing NM_026679.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGACGGCCACAGGCGCCGGCTACTTCCAGAGGGGCAGCTTGTTCTGGTTCACAGTCATCACCGTC
TCCTTCGGCTACTACACGTGGGCTGTCTTCTGGCCTCAGAGCATCCCTTATCAGAGCCTTGGGCCCCTG
GGTCCCTTCACGAAGTATTTGGTGGACCACTATCACACCTTCCTAAGGAATGGGTATTGGCTTGCTTGG
CTAATTCATGTGGGAGAGTCCTTGTATGCCTTGGTTTTATGCAAGCGTAAAGGAATCACAGACGTCCAG
GCCCAGCTCCTCTGGTTCCTACAGACTTTTCTGTTTGGTGTAGCCTCTCTCTCCATCCTGATTGCTTAC
AGATCAAAGCGCCAAAAACACAATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_026679
Insert Size 372 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_026679.2
RefSeq Size 2149 bp
RefSeq ORF 372 bp
Locus ID 66039
UniProt ID P0DN89
Cytogenetics 14 15.19 cM
MW 14.2 kDa
Write Your Own Review
You're reviewing:Tmem254a (NM_026679) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MR200615 Tmem254a (Myc-DDK-tagged) - Mouse DNA segment, Chr 14, ERATO Doi 449, expressed (D14Ertd449e), transcript variant 1 10 ug
$289.00
MR200615L3 Lenti ORF clone of Tmem254a (Myc-DDK-tagged) - Mouse DNA segment, Chr 14, ERATO Doi 449, expressed (D14Ertd449e), transcript variant 1 10 ug
$450.00
MR200615L4 Lenti ORF clone of Tmem254a (mGFP-tagged) - Mouse DNA segment, Chr 14, ERATO Doi 449, expressed (D14Ertd449e), transcript variant 1 10 ug
$450.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.