Mrpl17 (BC010718) Mouse Untagged Clone

SKU
MC206870
Mrpl17 (untagged) - Mouse mitochondrial ribosomal protein L17 (cDNA clone MGC:6922 IMAGE:2811255), (10ug)
$165.00
2 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Mrpl17
Synonyms MRP-L26; Rpml26
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC206870 representing BC010718.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGGTTGTCGCTGGCTGCCGCTATCTCCCACGGCCGCGTCTACCGCCGCCTGGGCCTGGGTCCGGAG
TCCCGCATCCATCTGCTGCGGAACTTGCTCACGGGCCTAGTTCGCCACGAACGCATCGAGGCGACATGG
GCACGCGCGGACGAGATGAGGGGCTACGCGGAGAAGCTCATCGATTATGGAAAGCTGGGCGACACCAAC
GAACGAGCCATGCGTATGGCTGACTTCTGGCTCACAGTGAGTGCTCCCTACCTGCTAGTGAGGAAGGAA
TCCTTAGAGAACCGGGTACCTGGCAGATTGAAGGCAGGGCATTCTTTTATGTACCAGACTTGCGAACTA
CCTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN BC010718
Insert Size 351 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC010718
RefSeq Size 1039 bp
RefSeq ORF 350 bp
Locus ID 27397
Cytogenetics 7 E3
MW 13.3 kDa
Write Your Own Review
You're reviewing:Mrpl17 (BC010718) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG200494 Mrpl17 (tGFP-tagged) - Mouse mitochondrial ribosomal protein L17 (cDNA clone MGC:6922 IMAGE:2811255) 10 ug
$350.00
MR200494 Mrpl17 (Myc-DDK-tagged) - Mouse mitochondrial ribosomal protein L17 (cDNA clone MGC:6922 IMAGE:2811255) 10 ug
$289.00
MR200494L3 Lenti ORF clone of Mrpl17 (Myc-DDK-tagged) - Mouse mitochondrial ribosomal protein L17 (cDNA clone MGC:6922 IMAGE:2811255) 10 ug
$450.00
MR200494L4 Lenti ORF clone of Mrpl17 (mGFP-tagged) - Mouse mitochondrial ribosomal protein L17 (cDNA clone MGC:6922 IMAGE:2811255) 10 ug
$450.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.