Igfbp2 (NM_008342) Mouse Untagged Clone

SKU
MC205719
Igfbp2 (untagged) - Mouse insulin-like growth factor binding protein 2 (Igfbp2), (10ug)
$300.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Igfbp2
Synonyms AI255832; IBP-2; IGFBP; Igfbp-2; mIGFBP-2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC012724
CCACGCGTCCGGGAGGCGTCTCCCGCATTCGTATGGGCCGTGCCACCTGCCCGCTAGCTCGCTGCACTAC CGTTGCCCACAAGCCAACATGCTGCCGAGATTGGGCGGCCCCGCGCTGCCGCTGCTCCTGCCGTCGTTGC TCTTGCTGCTGCTCTTGGGCGCGGGCGGCTGCGGCCCCGGGGTGCGCGCCGAGGTGCTGTTCCGCTGCCC ACCCTGCACGCCCGAGCGTCTGGCCGCTTGCGGGCCCCCACCCGACGCGCCCTGCGCCGAGCTGGTGCGA GAGCCCGGCTGCGGCTGCTGCTCCGTGTGCGCACGGCAGGAGGGCGAAGCATGCGGCGTCTACATCCCGC GCTGCGCCCAGACGCTACGCTGCTATCCCAACCCGGGCTCCGAGCTGCCCCTGAAGGCGCTTGTCACAGG CGCGGGTACCTGTGAAAAGAGACGCGTGGGCACCACCCCACAGCAGGTTGCAGACAGTGATGACGACCAC TCTGAGGGAGGCCTGGTGGAGAACCACGTGGATGGGACCATGAACATGTTGGGAGGTGGTAGCAGTGCTG GCCGGAAGCCCCTCAAGTCAGGCATGAAGGAGCTGGCTGTGTTCCGGGAGAAGGTCAATGAACAGCACCG GCAGATGGGCAAGGGTGCCAAACACCTCAGTCTGGAGGAGCCCAAGAAGTTGCGCCCGCCTCCCGCCAGG ACCCCTTGCCAGCAGGAGTTGGACCAGGTCCTGGAGCGGATCTCCACCATGCGCCTTCCGGATGATCGGG GCCCCCTGGAACATCTCTACTCCCTGCACATCCCCAACTGTGACAAGCATGGCCGGTACAACCTTAAGCA GTGCAAGATGTCTCTGAACGGACAGCGCGGGGAGTGCTGGTGTGTGAACCCCAACACCGGGAAGCCCATC CAGGGAGCTCCCACCATCCGGGGAGACCCCGAGTGCCATCTCTTCTACAACGAGCAGCAGGAGACTGGTG GGGCCCATGCCCAAAGTGTGCAGTAAACCCCAGCCAGTCGGTGCCTGGCTTCCCCATCCCGAACACCAGC AGAAATGGAGGGCGTCAGGGTGACGGGTGTGGAGGAGTTCCCAGTTTTGACACATGTATTTATATTTGGA AAGAGACCAACACTGAGCTCAGAAGCCCCCCTCTGACCCCCCCCAGCGGCTGTTAAGCTGAACCTCCCTT GCTTCTGTTAGAGAGGGGAAGGGTGGTATGGAGGGCACTGGGTACAGGCCTGGGAATGGGGAAAGAAATT TTTATTTTTGAATCCCTGTGTCTCTTTTACTTAAGATTAAAGGAAGGAAAAATAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI
ACCN NM_008342
Insert Size 918 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC012724, AAH12724
RefSeq Size 1355 bp
RefSeq ORF 918 bp
Locus ID 16008
UniProt ID P47877
Cytogenetics 1 36.94 cM
Summary The protein encoded by this gene is one of several similar proteins that bind insulin-like growth factors I and II (Igf-I and Igf-II). The encoded protein can be secreted into the bloodstream, where it binds Igf-I and Igf-II with high affinity, or it can remain intracellular, interacting with many different ligands. Two transcript variants, one encoding a secreted isoform and the other encoding a nonsecreted isoform, have been found for this gene. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
Write Your Own Review
You're reviewing:Igfbp2 (NM_008342) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG204287 Igfbp2 (tGFP-tagged) - Mouse insulin-like growth factor binding protein 2 (Igfbp2) 10 ug
$500.00
MR204287 Igfbp2 (Myc-DDK-tagged) - Mouse insulin-like growth factor binding protein 2 (Igfbp2) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR204287L1 Lenti ORF clone of Igfbp2 (Myc-DDK-tagged) - Mouse insulin-like growth factor binding protein 2 (Igfbp2) 10 ug
$600.00
MR204287L2 Lenti ORF clone of Igfbp2 (mGFP-tagged) - Mouse insulin-like growth factor binding protein 2 (Igfbp2) 10 ug
$600.00
MR204287L3 Lenti ORF clone of Igfbp2 (Myc-DDK-tagged) - Mouse insulin-like growth factor binding protein 2 (Igfbp2) 10 ug
$600.00
MR204287L4 Lenti ORF clone of Igfbp2 (mGFP-tagged) - Mouse insulin-like growth factor binding protein 2 (Igfbp2) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.