Ucp2 (NM_011671) Mouse Untagged Clone

SKU
MC205697
Ucp2 (untagged) - Mouse uncoupling protein 2 (mitochondrial, proton carrier) (Ucp2), nuclear gene encoding mitochondrial protein, (10ug)
$450.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ucp2
Synonyms Slc25a8; UCP 2; UCPH
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC012967
CCACGCGTCCGCACAATAGTATGAACTTTAAGTGTTTCGTCTCCCAGCCATTTTCTATGGAAAATCGAGG GGATCGGGCCATGGTAGCCACCGGCAGCTTTGAAGAACGAGACACCTTTAGAGAAGCTTGACCTTGGAGG CCTCAGCCTGAGACCTCAAAGCAGCCTCCAGAACTCCGGCAGAGTTCCTCTGTCTCGTCTTGCCGATTGA AGGTCCCCGTTTCTCCAATTTCTCTCCATCTTCTGGGAGGTAGCAGGAAATCAGAATCATGGTTGGTTTC AAGGCCACAGATGTGCCCCCAACAGCCACTGTGAAGTTCCTGGGGGCTGGGACAGCTGCCTGCATTGCAG ATCTCATCACTTTCCCTCTGGATACCGCCAAGGTCCGGCTGCAGATCCAAGGGGAGAGTCAAGGGCTAGT GCGCACCGCAGCCAGCGCCCAGTACCGTGGCGTTCTGGGTACCATCCTAACCATGGTGCGCACTGAGGGT CCACGCAGCCTCTACAATGGGCTGGTCGCCGGCCTGCAGCGCCAGATGAGCTTTGCCTCCGTCCGCATTG GCCTCTACGACTCTGTCAAACAGTTCTACACCAAGGGCTCAGAGCATGCAGGCATCGGGAGCCGCCTCCT GGCAGGTAGCACCACAGGTGCCCTGGCCGTGGCTGTAGCCCAGCCTACAGATGTGGTAAAGGTCCGCTTC CAGGCTCAGGCCCGGGCTGGTGGTGGTCGGAGATACCAGAGCACTGTCGAAGCCTACAAGACCATTGCAC GAGAGGAAGGGATCCGGGGCCTCTGGAAAGGGACTTCTCCCAATGTTGCCCGTAATGCCATTGTCAACTG TGCTGAGCTGGTGACCTATGACCTCATCAAAGATACTCTCCTGAAAGCCAACCTCATGACAGATGACCTC CCTTGCCACTTCACTTCTGCCTTCGGGGCCGGCTTCTGCACCACCGTCATCGCCTCCCCTGTTGATGTGG TCAAGACGAGATACATGAACTCTGCCTTGGGCCAGTACCACAGCGCAGGTCACTGTGCCCTTACCATGCT CCGGAAGGAGGGACCCCGCGCCTTCTACAAGGGGTTCATGCCTTCCTTTCTCCGCTTGGGATCCTGGAAC GTAGTGATGTTTGTCACCTATGAGCAGCTCAAAAGAGCCCTAATGGCTGCCTACCAATCTCGGGAGGCAC CTTTCTGAGCCTCTCCATGCTGACCTGGACCCTGCTTCCCAGCCCTGCCCTGTCTTTTTCTTCATCCTCT GCCCAGTCCCATTCTCTTCCCATTTCCTGCACCCCGATTTACTTCCCACCTCACCTCCCTGTGCCTCTGT ACTGATGACTCACAGTGAGGAGGCCTGACACCAGACCCTGAGCCCTCAGCCCTTTCTACAGCTAAGCCCA CATCTTCATCTTCATCCCCAGCCCAGCCCAGCCCAGCTCAGCCAGCCTTCACCCATAAAGCAAGCTCAAT GTTAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI
ACCN NM_011671
Insert Size 930 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC012967, AAH12967
RefSeq Size 1488 bp
RefSeq ORF 930 bp
Locus ID 22228
UniProt ID P70406
Cytogenetics 7 54.36 cM
Summary UCP are mitochondrial transporter proteins that create proton leaks across the inner mitochondrial membrane, thus uncoupling oxidative phosphorylation from ATP synthesis. As a result, energy is dissipated in the form of heat (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Ucp2 (NM_011671) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG204388 Ucp2 (tGFP-tagged) - Mouse uncoupling protein 2 (mitochondrial, proton carrier) (Ucp2) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
MR204388 Ucp2 (Myc-DDK-tagged) - Mouse uncoupling protein 2 (mitochondrial, proton carrier) (Ucp2), nuclear gene encoding mitochondrial protein 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR204388L1 Lenti ORF clone of Ucp2 (Myc-DDK-tagged) - Mouse uncoupling protein 2 (mitochondrial, proton carrier) (Ucp2), nuclear gene encoding mitochondrial protein 10 ug
$600.00
MR204388L2 Lenti ORF clone of Ucp2 (mGFP-tagged) - Mouse uncoupling protein 2 (mitochondrial, proton carrier) (Ucp2), nuclear gene encoding mitochondrial protein 10 ug
$600.00
MR204388L3 Lenti ORF clone of Ucp2 (Myc-DDK-tagged) - Mouse uncoupling protein 2 (mitochondrial, proton carrier) (Ucp2), nuclear gene encoding mitochondrial protein 10 ug
$600.00
MR204388L4 Lenti ORF clone of Ucp2 (mGFP-tagged) - Mouse uncoupling protein 2 (mitochondrial, proton carrier) (Ucp2), nuclear gene encoding mitochondrial protein 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.