Comtd1 (NM_026965) Mouse Untagged Clone

SKU
MC205031
Comtd1 (untagged) - Mouse catechol-O-methyltransferase domain containing 1 (Comtd1), (10ug)
$300.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Comtd1
Synonyms 1810030M08Rik; MT773
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC049670
ACGTGACCTCCGCCGCCGCTGCTAACCTGCACCATGGCTCAGCCCGTCCCTCGGCTATCTATCCCAGCCG CACTGGCCCTGGGCTCGGCCGCGCTGGGCGCCGCCTTCGCTACTGGTCTCTTGCTGGGGAAACGGTGGCC TCCATGGGGGTCCAGGCGGCAAGAGCGCCTGCTGCCACCTGAGGACAATCCCCTGTGGCAGTATCTGCTG AGCCGCTCCATGAGAGAGCACCCGGCGCTGCGGAGCCTGCGACTGCTGACCCTGGAGCAGCCGCAGGGGG ATTCCATGATGACCTGTGAACAGGCCCAGCTTCTGGCCAACCTGGCGCGGCTCATTAAGGCCAAGAAAGC TCTGGATCTGGGTACTTTCACGGGCTACTCGGCCCTGGCCCTAGCCTTGGCGCTTCCGGAGGCTGGCCGC GTGGTGACCTGCGAGGTTGACGCAGAGCCCCCGAAGCTGGGACGGCCCATGTGGAAGCAGGCAGAAGTGG AGCAGAAGATCGACCTTCGGCTGCAGCCCGCCCTGCAGACATTGGATGAGCTCCTAGCGGCGGGCGAGGC CGGAACCTTCGACATAGCCGTGGTGGACGCGGACAAAGAGAACTGTACCGCCTACTACGAGCGCTGTCTG CAGCTCCTACGTCCCGGAGGCGTGCTCGCTGTACTCAGAGTCCTGTGGCGCGGAGAAGTGCTGCAGCCTC AGCCCAGGAACAAGACTGTTGAATGTGTGCGGAACCTGAACGAACGCATCCTGAGGGACGCCAGGGTCTA CATCAGCCTCCTGCCCCTGGATGATGGCCTCTCCTTGGCCTTTAAGATCTAGGGTTAACACGAAGCTTAG GGCCTGGGTGTGAGAACCTAAGACCCCCAGCCAGTGACCTGACTTTTAAACCTGACAATAAAGGTACTGG ACACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites SfiI-SfiI
ACCN NM_026965
Insert Size 789 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC049670, AAH49670
RefSeq Size 946 bp
RefSeq ORF 789 bp
Locus ID 69156
UniProt ID Q8BIG7
Cytogenetics 14 A3
Summary Putative O-methyltransferase.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Comtd1 (NM_026965) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG203455 Comtd1 (tGFP-tagged) - Mouse catechol-O-methyltransferase domain containing 1 (Comtd1) 10 ug
$500.00
MR203455 Comtd1 (Myc-DDK-tagged) - Mouse catechol-O-methyltransferase domain containing 1 (Comtd1) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR203455L3 Lenti ORF clone of Comtd1 (Myc-DDK-tagged) - Mouse catechol-O-methyltransferase domain containing 1 (Comtd1) 10 ug
$600.00
MR203455L4 Lenti ORF clone of Comtd1 (mGFP-tagged) - Mouse catechol-O-methyltransferase domain containing 1 (Comtd1) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.