Gast (NM_010257) Mouse Untagged Clone

SKU MC204768

Gast (untagged) - Mouse gastrin (Gast), (10ug)

Product Data

• Type: Mouse Untagged Clone
• Target Symbol: Gast
• Synonyms: G; GAS
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC064791; CGGACGCGTGGGAGCGCCACAACAGCCAACTATTCCCCAGCTCTGTGGACAAGATGCCTCGACTGTGTGT GTACATGCTGGTCTTAGTGCTGGCTCTAGCTACCTTCTCGGAAGCTTCTTGGAAGCCCCGCTCCCAGCTA CAGGATGCATCATCTGGACCAGGGACCAATGAGGACCTGGAACAGCGCCAGTTCAACAAGCTGGGCTCAG CCTCTCACCATCGAAGGCAGCTGGGGCTCCAGGGTCCTCAACACTTCATAGCAGACCTGTCCAAGAAGCA GAGGCCACGAATGGAGGAAGAAGAAGAGGCCTACGGATGGATGGACTTTGGCCGCCGCAGTGCTGAGGAA GACCAGTAGGACTAGCAACACTCTTCCAGAGCCCAGCCATCTCCAGCCACCCCTCCCCCAGCTCCGTCCT TACAAAACATATTAAAAATAAGCTAGCTTCCAATGTAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_010257
• Insert Size: 306 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: BC064791, AAH64791
• RefSeq Size: 478 bp
• RefSeq ORF: 306 bp
• Locus ID: 14459
• UniProt ID: P48757
• Cytogenetics: 11 63.46 cM
• Summary: This gene encodes the peptide hormone gastrin, which stimulates gastric acid secretion, proliferation, cell migration and angiogenesis, as well as inhibits apoptosis. The encoded preproprotein undergoes proteolytic processing to generate multiple gastrin peptides differing in size. Mice lacking the encoded protein exhibit a decrease in the number of parietal cells, achlorohydria and a decrease in the colonic proliferation. [provided by RefSeq, Nov 2015]