Icam2 (NM_010494) Mouse Untagged Clone

SKU
MC204552
Icam2 (untagged) - Mouse intercellular adhesion molecule 2 (Icam2), (10ug)
$300.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Icam2
Synonyms CD102; Icam-2; Ly-60
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC039128
AGCAGACATCTCTCCCTAACCCTCCAGGCAGCCGTCAGCTGTGCCCCTGAAGCCCATAGACTCCACAGAC CCCACAGACCCCACCTGAGATGTCTTCTTTTGCTTGCTGGAGCCTGTCTCTTCTTATCCTGTTCTACAGC CCAGGGTCTGGTGAGAAGGCCTTTGAGGTCTACATATGGTCCGAGAAGCAGATAGTAGAAGCCACAGAGT CTTGGAAAATCAACTGCAGCACCAACTGCGCAGCCCCAGACATGGGCGGCCTGGAGACGCCCACGAATAA AATAATGTTGGAAGAGCATCCTCAAGGGAAGTGGAAACAGTTCTTAGTCTCAAACGTCTCCAAAGACACG GTCTTCTTTTGCCATTTCACGTGTTCGGGAAAGCAGCACTCGGAGAGTCTCAACATCAGGGTGTACCAGC CTCCAGCTCAAGTCACACTGAAGCTGCAGCCGCCTCGGGTGTTTGTGGGTGAAGACTTCACCATTGAGTG CACGGTGTCCCCTGTGCAGCCCCTTGAGAGGCTCACCCTCTCTCTGCTCCGTGGCAGAGAGACCCTGAAG AATCAGACCTTTGGGGGAGCAGAAACTGTCCCCCAAGAGGCCACAGCCACGTTCAACAGCACAGCTCTGA AAAAGGACGGTCTCAACTTTTCCTGCCAGGCTGAGCTGGATCTACGGCCCCATGGTGGGTATATCATCCG CAGCATCTCGGAGTACCAGATCCTTGAAGTCTATGAGCCGATGCAGGACAACCAAATGGTCATCATCATC GTGGTGGTGTCAATACTGCTGTTCTTATTTGTGACATCTGTCCTGCTATGCTTTATCTTTGGCCAGCACT GGCACAGAAGACGGACAGGCACCTACGGGGTGCTAGCTGCCTGGAGGAGGCTGCCCCGAGCCTTTCGGGC ACGTCCCGTGTGAGCCCACGTTGCCAGGCCCCTGGTGGTTACCAGAACTCAACATGGCACCTTCAAGGTG TGGTTCGGCACTGGCTGAAGGACTGTGGCGGCAGCAGCAGATGCGGGGGACATTTCCTCTCCTTTTTAGC CTCAATACAAATATCTGGATTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI
ACCN NM_010494
Insert Size 834 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC039128, AAH39128
RefSeq Size 1105 bp
RefSeq ORF 834 bp
Locus ID 15896
UniProt ID P35330
Cytogenetics 11 69.09 cM
Summary ICAM proteins are ligands for the leukocyte adhesion protein LFA-1 (integrin alpha-L/beta-2). ICAM2 may play a role in lymphocyte recirculation by blocking LFA-1-dependent cell adhesion. It mediates adhesive interactions important for antigen-specific immune response, NK-cell mediated clearance, lymphocyte recirculation, and other cellular interactions important for immune response and surveillance.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Icam2 (NM_010494) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG203730 Icam2 (tGFP-tagged) - Mouse intercellular adhesion molecule 2 (Icam2) 10 ug
$500.00
MR203730 Icam2 (Myc-DDK-tagged) - Mouse intercellular adhesion molecule 2 (Icam2) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR203730L3 Lenti ORF clone of Icam2 (Myc-DDK-tagged) - Mouse intercellular adhesion molecule 2 (Icam2) 10 ug
$600.00
MR203730L4 Lenti ORF clone of Icam2 (mGFP-tagged) - Mouse intercellular adhesion molecule 2 (Icam2) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.