Endog (NM_007931) Mouse Untagged Clone

SKU
MC204029
Endog (untagged) - Mouse endonuclease G (Endog), nuclear gene encoding mitochondrial protein, (10ug)
$300.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Endog
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC030177
CCACGCGTCCGCTCCTTCACTCTGTGCTAACATCAGTAGCGTCCTTGTCCTCCGGTAGGCATGCGCGCGC TGCGGGCCGGCCTGACCCTAGCGCTGGGCGCGGGGCTGGGCGCCGCGGCAGAGCATTGGCGGCGGCGGGA GGGCAAAGCGCCGGGGCTGCTGGGCCGAGTGCCATTGTTGCCGGTGGTCGCGGCCGATCTTCCCGCGCTG CCGGGGGGACCGGCGGGCGGCACCGGGGAACTGGCCAAGTACGGGCTGCCCGGCGTGGCGCAGCTCCGGA GCCGCGAGTCCTACGTGCTTAGCTACGACCCGCGCACGCGCGGTGCGCTCTGGGTGTTGGAGCAGCTGAG GCCAGAGCGGCTCCGTGGCGACGGGGACCGTAGCGCCTGCGACTTCCGCGAGGATGACTCTGTGCACGCG TACCACCGCGCCACCAATGCGGACTACCGCGGCAGTGGCTTTGACCGCGGCCATTTGGCCGCCGCCGCCA ACCACCGCTGGAGTCAGCGGGCCATGGACGACACCTTCTACCTGAGCAACGTAGCGCCTCAGGTGCCACA CCTCAACCAGAATGCCTGGAACAACCTTGAGAGGTACAGCCGCAGCTTGACGCGAACTTACCAAAATGTC TATGTCTGCACGGGGCCGCTTTTCCTGCCCAGGACCGAGGCTGATGGGAAGTCCTATGTGAAGTACCAGG TTATTGGGAAGAACCACGTGGCAGTGCCCACACACTTCTTCAAGGTGCTGATCCTGGAGGCAGCCGGTGG GCAGATCGAGCTACGTTCCTACGTGATGCCCAATGCCCCCGTGGATGAGACCATCCCTCTGGAGCGGTTC CTGGTGCCCATCGAGAGCATCGAGCGGGCCTCGGGATTGCTCTTCGTGCCCAATATTCTGGCTCGAGCTG GAAACCTCAAGGCTATCACTGCTGGCAGCAAGTGATGGTGGAGGACTCACTGGAGCCCCTGGGGAGATGG GCTGACTCACATTAAAGGCAGTTATTTTTGGAGAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI
ACCN NM_007931
Insert Size 885 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC030177, AAH30177
RefSeq Size 1036 bp
RefSeq ORF 885 bp
Locus ID 13804
UniProt ID O08600
Cytogenetics 2 B
Summary Cleaves DNA at double-stranded (DG)n.(DC)n and at single-stranded (DC)n tracts. In addition to deoxyribonuclease activities, also has ribonuclease (RNase) and RNase H activities. Capable of generating the RNA primers required by DNA polymerase gamma to initiate replication of mitochondrial DNA (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Endog (NM_007931) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG204047 Endog (tGFP-tagged) - Mouse endonuclease G (Endog) 10 ug
$500.00
MR204047 Endog (Myc-DDK-tagged) - Mouse endonuclease G (Endog), nuclear gene encoding mitochondrial protein 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR204047L3 Lenti ORF clone of Endog (Myc-DDK-tagged) - Mouse endonuclease G (Endog), nuclear gene encoding mitochondrial protein 10 ug
$600.00
MR204047L4 Lenti ORF clone of Endog (mGFP-tagged) - Mouse endonuclease G (Endog), nuclear gene encoding mitochondrial protein 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.