Thoc7 (NM_025435) Mouse Untagged Clone
SKU
MC202356
Thoc7 (untagged) - Mouse THO complex 7 homolog (Drosophila) (Thoc7), transcript variant 1, (10ug)
Product Data | |
Type | Mouse Untagged Clone |
---|---|
Target Symbol | Thoc7 |
Synonyms | Nif3l1bp1 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>BC054419 sequence for NM_025435
CTGCATTGTGGGAGTTTGACCTTCGCCGCCAACCGCCGCCTCAGCTCGCGCCGCCGCCGCCGCGCACGCC ATGGGAGCCGTGACTGACGACGAAGTTATACGGAAACGTCTTCTGATTGATGGAGATGGTGCTGGGGATG ATCGGAGAATTAATCTCCTCGTGAAAAGCTTCATTAAATGGTGCAACTCTGGATCCCAAGAGGAAGGGTA TAGCCAGTACCAACGCATGCTGAGCACTCTGTCCCAGTGTGAATTTTCAATGGGCAAAACATTGCTGGTA TATGATATGAATCTCAGAGAAATGGAAAATTATGAAAAAATATACAAAGAAATAGAATGTAGTATTGCTG GAGCACATGAAAAAATTGCTGAGTGTAAAAAGCAGATTCTTCAAGCAAAACGAATACGAAAAAATCGACA AGAATATGACGCTTTGGCCAAAATGATCCAGCATCACCCAGATAGGCATGAGACACTGAAGGAGCTAGAG GCTCTGGGCAAAGAATTAGAGCATCTCTCACATATTAAAGAAAGTGTTGAAGATAAGCTGGAATTGAGAC GGAAACAATTTCACGTTCTTCTTAGTACCATCCATGAACTTCAACAGACATTGGAGAATGATGACAAGCT GTCAGAGGTGGATGAAGCTCAAGAAAGCACCATGGAAGCAGACCCTAAGCCGTAGATGGGCTGACCGTCG CCATTTACAGGGACAGCGAATAGCTGCATGGGCTTCCTGGGTTCAGTGTGTTGTACTTTTGGGATATTTC AACTTCAGCATTGAAGTACTTTGCTTTCAAGTATTCATGTGTCATTCATATTTCTTCACAGAACGGAAAT GTATCCCATATATATGTATTTTTTAAATACATTTTTATCCTTAAACATAGAAATCAGCATCTGAAAATAT TTAATAAAATGTCTCAAGGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAG |
Restriction Sites | RsrII-NotI |
ACCN | NM_025435 |
Insert Size | 615 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | BC054419, AAH54419 |
RefSeq Size | 993 bp |
RefSeq ORF | 615 bp |
Locus ID | 66231 |
UniProt ID | Q7TMY4 |
Cytogenetics | 14 A1 |
Summary | Required for efficient export of polyadenylated RNA. Acts as component of the THO subcomplex of the TREX complex which is thought to couple mRNA transcription, processing and nuclear export, and which specifically associates with spliced mRNA and not with unspliced pre-mRNA. TREX is recruited to spliced mRNAs by a transcription-independent mechanism, binds to mRNA upstream of the exon-junction complex (EJC) and is recruited in a splicing- and cap-dependent manner to a region near the 5' end of the mRNA where it functions in mRNA export to the cytoplasm via the TAP/NFX1 pathway.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
MR202136 | Thoc7 (Myc-DDK-tagged) - Mouse THO complex 7 homolog (Drosophila) (Thoc7), transcript variant 1 | 10 ug |
$289.00
MSRP
$300.00
MSRP
$300.00
|
|
MR202136L3 | Lenti ORF clone of Thoc7 (Myc-DDK-tagged) - Mouse THO complex 7 homolog (Drosophila) (Thoc7), transcript variant 1 | 10 ug |
$600.00
|
|
MR202136L4 | Lenti ORF clone of Thoc7 (mGFP-tagged) - Mouse THO complex 7 homolog (Drosophila) (Thoc7), transcript variant 1 | 10 ug |
$600.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.