Mylpf (NM_016754) Mouse Untagged Clone

SKU
MC202342
Mylpf (untagged) - Mouse myosin light chain, phosphorylatable, fast skeletal muscle (Mylpf), (10ug)
$300.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Mylpf
Synonyms 2410014J02Rik; MLC-2; Mlc2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC055869 sequence for NM_016754
TCTGGAGCTACTGCCTTGCCCCCAGGAGATCTAAGACATGGCACCCAAGAAGGCCAAGAGAAGGGCAGGA GCGGAAGGGAGCTCCAACGTCTTCTCCATGTTTGACCAGACTCAGATCCAGGAGTTCAAGGAGGCGTTCA CTGTAATTGATCAGAACAGGGATGGCATTATCGACAAAGAGGATCTTCGGGACACCTTTGCAGCCATGGG CCGTCTCAATGTGAAGAATGAGGAACTCGACGCTATGATGAAGGAAGCCAGTGGGCCCATCAACTTCACT GTCTTCCTGACCATGTTTGGGGAAAAGCTTAAGGGTGCGGACCCGGAGGATGTGATCACTGGAGCCTTCA AGGTCCTGGACCCAGAAGGGAAGGGCACCATCAAAAAGCAGTTCTTGGAGGAGCTGCTTACCACGCAGTG CGACCGATTTTCCCAGGAGGAGATCAAGAACATGTGGGCAGCCTTCCCCCCAGACGTGGGCGGCAACGTG GACTACAAGAACATCTGCTACGTCATCACACATGGTGATGCTAAGGACCAGGAATAGGGGACCCAAGGTC TCAGAAGACCTAGATAGGCTTGTAGCCGCTCCAACTCTCACCCTGACCCTCAATAAAACTCAACTGGTCT TTGTTTCTTAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI
ACCN NM_016754
Insert Size 510 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC055869, AAH55869
RefSeq Size 657 bp
RefSeq ORF 510 bp
Locus ID 17907
UniProt ID P97457
Cytogenetics 7 F3
Write Your Own Review
You're reviewing:Mylpf (NM_016754) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG201414 Mylpf (tGFP-tagged) - Mouse myosin light chain, phosphorylatable, fast skeletal muscle (Mylpf) 10 ug
$500.00
MR201414 Mylpf (Myc-DDK-tagged) - Mouse myosin light chain, phosphorylatable, fast skeletal muscle (Mylpf) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR201414L3 Lenti ORF clone of Mylpf (Myc-DDK-tagged) - Mouse myosin light chain, phosphorylatable, fast skeletal muscle (Mylpf) 10 ug
$600.00
MR201414L4 Lenti ORF clone of Mylpf (mGFP-tagged) - Mouse myosin light chain, phosphorylatable, fast skeletal muscle (Mylpf) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.